dnm1l

Ensembl ID:
ENSDARG00000015006
ZFIN ID:
ZDB-GENE-040426-1556
Description:
Dynamin-1-like protein [Source:UniProtKB/Swiss-Prot;Acc:Q7SXN5]
Human Orthologue:
DNM1L
Human Description:
dynamin 1-like [Source:HGNC Symbol;Acc:2973]
Mouse Orthologue:
Dnm1l
Mouse Description:
dynamin 1-like Gene [Source:MGI Symbol;Acc:MGI:1921256]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44293 Nonsense Mutation detected in F1 DNA During 2017
sa24668 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa44293
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006840 Nonsense 116 691 4 18
ENSDART00000133860   None 94 None 3
ENSDART00000145987   None 228 None 7
Genomic Location (Zv9):
Chromosome 25 (position 20739494)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20150283
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTACACAGATTTTGATGAAATCAGGCAAGAAATTGAAAATGAAACAGAA[A/T]GAGTTTCTGGCAATAACAAGGTACAAAGTCACGTGATGTTTTTTGCACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24668
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006840 Nonsense 127 691 5 18
ENSDART00000133860   None 94 None 3
ENSDART00000145987   None 228 None 7
Genomic Location (Zv9):
Chromosome 25 (position 20736903)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 20147692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATATCCTTAAAATCCCTCTTGTGTCATTTTTTCTTAGGGCATCAGTGAT[G/T]AGCCCATACACCTGAAAATCTTCTCTCCACATGTTGTCAACCTCACGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link