arhgap4b

Ensembl ID:
ENSDARG00000015003
ZFIN ID:
ZDB-GENE-090311-38
Human Orthologue:
ARHGAP4
Human Description:
Rho GTPase activating protein 4 [Source:HGNC Symbol;Acc:674]
Mouse Orthologue:
Arhgap4
Mouse Description:
Rho GTPase activating protein 4 Gene [Source:MGI Symbol;Acc:MGI:2159577]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15978 Nonsense Available for shipment Available now
sa3230 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa15978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051182 Nonsense 65 943 2 23
ENSDART00000138792 Nonsense 65 957 2 24
Genomic Location:
Chromosome 23 (position 18839097)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATMTGAGCGARTACCTGCGCAGACGAGGAGAGATTGAGGCTGAATATGCC[C/T]GATCTCTGGAGAAACTSAGTGAGAAGTTCACAGTGAAGACCAAGAGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3230
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051182 Essential Splice Site 135 943 4 23
ENSDART00000138792 Essential Splice Site 135 957 4 24
Genomic Location:
Chromosome 23 (position 18832789)
KASP Assay ID:
554-3176.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGCCAAACCATCTTCCTCCTTTCAAACTGACTCGTATTCTCTGTTTC[A/T]GAGCAAGGAGGTTGGACTCCAGATGCAGGATGAGCTTTTGAAAATCACCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tmwhqarp