arhgap4b

Ensembl ID:
ENSDARG00000015003
ZFIN ID:
ZDB-GENE-090311-38
Human Orthologue:
ARHGAP4
Human Description:
Rho GTPase activating protein 4 [Source:HGNC Symbol;Acc:674]
Mouse Orthologue:
Arhgap4
Mouse Description:
Rho GTPase activating protein 4 Gene [Source:MGI Symbol;Acc:MGI:2159577]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15978 Nonsense Available for shipment Available now
sa37665 Essential Splice Site Mutation detected in F1 DNA During 2016
sa3230 Essential Splice Site F2 line generated During 2016
sa43944 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa15978
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051182 Nonsense 65 943 2 23
ENSDART00000138792 Nonsense 65 957 2 24
Genomic Location (Zv9):
Chromosome 23 (position 18839097)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18742036
KASP Assay ID:
2261-7537.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATMTGAGCGARTACCTGCGCAGACGAGGAGAGATTGAGGCTGAATATGCC[C/T]GATCTCTGGAGAAACTSAGTGAGAAGTTCACAGTGAAGACCAAGAGGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37665
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051182 Essential Splice Site 134 943 3 23
ENSDART00000138792 Essential Splice Site 134 957 3 24
Genomic Location (Zv9):
Chromosome 23 (position 18832942)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18735881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGCGCCTCTCACACTGCATAGAGGACACACACCGCCTGGCAAAGCGGG[T/G]ATACAAATCTCTCCCACTCTATTACCAGCTCCGACAGTTAATTCTCCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3230
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051182 Essential Splice Site 135 943 4 23
ENSDART00000138792 Essential Splice Site 135 957 4 24
Genomic Location (Zv9):
Chromosome 23 (position 18832789)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18735728
KASP Assay ID:
554-3176.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAGCCAAACCATCTTCCTCCTTTCAAACTGACTCGTATTCTCTGTTTC[A/T]GAGCAAGGAGGTTGGACTCCAGATGCAGGATGAGCTTTTGAAAATCACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43944
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000051182 Nonsense 162 943 5 23
ENSDART00000138792 Nonsense 162 957 5 24
Genomic Location (Zv9):
Chromosome 23 (position 18830005)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 18732944
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCATGTTGTAAAAGTGTTGAATGTTTTGCAGGCTTTGAAAACTTATCAT[C/T]AATACCACATCGACTGTCTGGCTGCAGAAGGCAAGCTCAAAGAAGCCACG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link