NP_571161.1

Ensembl ID:
ENSDARG00000015002
Description:
cadherin 4, retinal isoform 1 [Source:RefSeq peptide;Acc:NP_571161]
Human Orthologue:
CDH4
Human Description:
cadherin 4, type 1, R-cadherin (retinal) [Source:HGNC Symbol;Acc:1763]
Mouse Orthologue:
Cdh4
Mouse Description:
cadherin 4 Gene [Source:MGI Symbol;Acc:MGI:99218]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17776 Nonsense Available for shipment Available now
sa6204 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa17776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097934 Nonsense 55 864 1 14
Genomic Location (Zv9):
Chromosome 11 (position 21011680)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20534938
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGAACCCATCCAGTTCATGGTGACAGCCAGAGACAGAGCAGGAGAGTA[T/G]ATCTGGGAGACCACTGTTAAACTGGCCCTCGCCGGACACCCACTTTCACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6204
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097934 Nonsense 141 864 3 14
Genomic Location (Zv9):
Chromosome 11 (position 21076064)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 20599322
KASP Assay ID:
554-4689.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTGATTATCTATAAAACTGCTGTCATTGTGCTGTTTTATTGCAGATT[C/T]GATCGGACCAGGACAAAAAGATTGAGATCCGGTACAGTATAACAGGAGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • β2-Glycoprotein I (β2-GPI) plasma levels: Genetic determinants of plasma β₂-glycoprotein I levels: a genome-wide association study in extended pedigrees from Spain. (View Study)
  • Longevity: Joint influence of small-effect genetic variants on human longevity. (View Study)
  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Sudden cardiac arrest: GWAS for discovery and replication of genetic loci associated with sudden cardiac arrest in patients with coronary artery disease. (View Study)
  • T-tau: Genome-wide association reveals genetic effects on human Aβ42 and τ protein levels in cerebrospinal fluids: a case control study. (View Study)
  • Volumetric brain MRI: Genetic correlates of brain aging on MRI and cognitive test measures: a genome-wide association and linkage analysis in the Framingham Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link