acvr1l

Ensembl ID:
ENSDARG00000014986
ZFIN ID:
ZDB-GENE-990415-9
Description:
activin receptor type-1 [Source:RefSeq peptide;Acc:NP_571420]
Human Orthologue:
ACVR1
Human Description:
activin A receptor, type I [Source:HGNC Symbol;Acc:171]
Mouse Orthologue:
Acvr1
Mouse Description:
activin A receptor, type 1 Gene [Source:MGI Symbol;Acc:MGI:87911]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2068 Essential Splice Site F2 line generated During 2014
sa8093 Essential Splice Site Mutation detected in F1 DNA During 2014
sa18736 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2068
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017977 Essential Splice Site None 506 2 11
ENSDART00000122860 None None 106 None 3
ENSDART00000127520 None None 506 None 9

The following transcripts of ENSDARG00000014986 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 41580791)
KASP Assay ID:
554-3372.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCGTGTCTGTGGAAACGGCTTAASATGCATCTTTGCTTCTGGACTTTTTA[G/T]GATCCAATGGGAAGACAGAGTCTGGCTGTGCGAATACTGAAAGGCAGYGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8093
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017977 Essential Splice Site None 506 3 11
ENSDART00000122860 Essential Splice Site None 106 2 3
ENSDART00000127520 None None 506 None 9

The following transcripts of ENSDARG00000014986 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 41580216)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGTATCTTGGCTAAAATTTGAGTTTTGTAACACCTCAATTTCTTTTCA[G/A]TGCATTGAACCAAATGGGGCATTGCAGCACCCAAATCATCATCCTGTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18736
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017977 Essential Splice Site 179 506 6 11
ENSDART00000122860 None None 106 None 3
ENSDART00000127520 Essential Splice Site 179 506 4 9

The following transcripts of ENSDARG00000014986 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 41573390)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTTATTTATTCATTGATGTTAGATGGTAACTAATATGTATGGTTTCCT[A/G]GGATCTGATGGATCACTCCTGCACTTCAGGCAGTGGTTCAGGACTGCCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/po4goxzk