ENSDARG00000014975

Ensembl ID:
ENSDARG00000014975
Mouse Orthologues:
Gm4951, Ifi47, Irgc1
Mouse Descriptions:
immunity-related GTPase family, cinema 1 Gene [Source:MGI Symbol;Acc:MGI:2685948]
interferon gamma inducible protein 47 Gene [Source:MGI Symbol;Acc:MGI:99448]
predicted gene 4951 Gene [Source:MGI Symbol;Acc:MGI:3644953]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa363 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa363
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059126 Nonsense 208 352 2 2
Genomic Location:
Chromosome 16 (position 28079817)
KASP Assay ID:
554-0182.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAAGAAACTTCGATGAGCGTGTGCTGCTTGATAAAATCCGAGAGGACTG[T/A]AAGGTGAACCTTCTCAAATTGAATATTTCCAAAATATTCCTAATATCTTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/e9i43x8k