ppp3cca

Ensembl ID:
ENSDARG00000014962
ZFIN ID:
ZDB-GENE-030829-36
Description:
protein phosphatase 3, catalytic subunit, gamma isoform-like [Source:RefSeq peptide;Acc:NP_00116010
Human Orthologue:
PPP3CC
Human Description:
protein phosphatase 3, catalytic subunit, gamma isozyme [Source:HGNC Symbol;Acc:9316]
Mouse Orthologue:
Ppp3cc
Mouse Description:
protein phosphatase 3, catalytic subunit, gamma isoform Gene [Source:MGI Symbol;Acc:MGI:107162]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa33612 Essential Splice Site Mutation detected in F1 DNA During 2018
sa20428 Nonsense Available for shipment Available now
sa16822 Essential Splice Site Available for shipment Available now
sa45205 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa33612
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080412 Essential Splice Site 126 499 3 13
ENSDART00000132740 Essential Splice Site 126 499 3 13
Genomic Location (Zv9):
Chromosome 5 (position 29620775)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27376073
GRCz11 5 27976226
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTATCTCTTTCTGGGCGATTATGTAGACAGGGGATACTTCAGTATTGAGG[T/G]GAGTAAGAGGTTTTTTTCTTTAGATATTCTGTTAACTAAGTTACTTTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20428
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080412 Nonsense 256 499 6 13
ENSDART00000132740 Nonsense 256 499 6 13
Genomic Location (Zv9):
Chromosome 5 (position 29595680)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27350978
GRCz11 5 27951131
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGACGGCAGAGCACTTTAACCACAACTCCGTCAGAGGCTGCTCCTA[T/G]TTCTTCAGGTACAACAGGAAAGGGTCATCCAGTTCATACATGTACAGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16822
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080412 Essential Splice Site 259 499 6 13
ENSDART00000132740 Essential Splice Site 259 499 6 13
Genomic Location (Zv9):
Chromosome 5 (position 29595670)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27350968
GRCz11 5 27951121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGCACTTTAAYCACAACWCCGTCAGAGGCTGCWCCTATTTCTTCAGG[T/C]ACAAMAGGAAAGGGTCATCCAGTTCATAYATGTACAGTGACTTAGATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45205
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080412 Essential Splice Site 384 499 10 13
ENSDART00000132740 Essential Splice Site 384 499 10 13
Genomic Location (Zv9):
Chromosome 5 (position 29588530)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 27343828
GRCz11 5 27943981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTGTTCTGATGATGAACTCATGTCAGAGGGAGATGACTTGTGCGAAG[G/A]TGAGGAGGTTTTCTTGTTTATGCACTCTGCAAATGCGTTTATCCAAAGAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link