si:dkey-1j5.3

Ensembl ID:
ENSDARG00000014953
ZFIN ID:
ZDB-GENE-041001-180
Description:
Novel protein similar to human and mouse cornichon homolog (Drosophila) (CNIH) [Source:UniProtKB/TrE
Human Orthologue:
CNIH3
Human Description:
cornichon homolog 3 (Drosophila) [Source:HGNC Symbol;Acc:26802]
Mouse Orthologue:
Cnih3
Mouse Description:
cornichon homolog 3 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1920228]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23768 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020997 Nonsense 87 160 4 6
ENSDART00000131867 Nonsense 105 168 5 6
Genomic Location (Zv9):
Chromosome 20 (position 36311105)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 36383618
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATACTCCATCCATGTCCTCTTCTGTATCATGTTCCTGTGTGCTCAGGAGT[G/A]GCTGACCGTAGGCCTCAATATCCCTCTGCTCTTCTACAACACATGGAGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link