LOC100332825

Ensembl ID:
ENSDARG00000014946
Human Orthologue:
ANGPT2
Human Description:
angiopoietin 2 [Source:HGNC Symbol;Acc:485]
Mouse Orthologue:
Angpt2
Mouse Description:
angiopoietin 2 Gene [Source:MGI Symbol;Acc:MGI:1202890]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22210 Essential Splice Site Available for shipment Available now
sa22209 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22210
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025463 Essential Splice Site 143 484 3 10
Genomic Location (Zv9):
Chromosome 13 (position 6238072)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6171064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCAGACAGCAGAGCAATCACGCAAAATCACAACTGTTGAAGCACAG[G/T]TAAAGGTTGACACGTCTCTCTAATCCAGCCAGCAGTGGTTCAGTTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025463 Essential Splice Site 388 484 8 10
Genomic Location (Zv9):
Chromosome 13 (position 6234130)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 6175006
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAAAATATAGCCAGTTCTCACTCGATGGAGAGAAGCAGAATTACAG[G/A]TGACAAATTTACTTATGCTTAGAATATATGTAAGATTTACCCTGTGTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link