LOC100332825

Ensembl ID:
ENSDARG00000014946
Human Orthologue:
ANGPT2
Human Description:
angiopoietin 2 [Source:HGNC Symbol;Acc:485]
Mouse Orthologue:
Angpt2
Mouse Description:
angiopoietin 2 Gene [Source:MGI Symbol;Acc:MGI:1202890]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22210 Essential Splice Site Mutation detected in F1 DNA During 2014
sa22209 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa22210
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025463 Essential Splice Site 143 484 3 10
Genomic Location:
Chromosome 13 (position 6238072)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAGTCAGACAGCAGAGCAATCACGCAAAATCACAACTGTTGAAGCACAG[G/T]TAAAGGTTGACACGTCTCTCTAATCCAGCCAGCAGTGGTTCAGTTTCAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22209
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025463 Essential Splice Site 388 484 8 10
Genomic Location:
Chromosome 13 (position 6234130)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTCAAAATATAGCCAGTTCTCACTCGATGGAGAGAAGCAGAATTACAG[G/A]TGACAAATTTACTTATGCTTAGAATATATGTAAGATTTACCCTGTGTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z15xxhzd