kif23

Ensembl ID:
ENSDARG00000014943
ZFIN ID:
ZDB-GENE-991019-4
Description:
kinesin-like protein KIF23 [Source:RefSeq peptide;Acc:NP_571430]
Human Orthologue:
KIF23
Human Description:
kinesin family member 23 [Source:HGNC Symbol;Acc:6392]
Mouse Orthologue:
Kif23
Mouse Description:
kinesin family member 23 Gene [Source:MGI Symbol;Acc:MGI:1919069]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32201 Essential Splice Site Available for shipment Available now
sa36634 Essential Splice Site Available for shipment Available now
sa23287 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32201
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012241 Essential Splice Site 105 867 4 22
ENSDART00000129688   None 611 None 14
ENSDART00000132993   None 151 None 3
Genomic Location (Zv9):
Chromosome 18 (position 20235593)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20465816
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGATGTTGCTAAACCTCTTGCCCAAGACCTCATTCATGGAAAAAATG[G/A]TAAATCCACTGTTCTTGAATAATTATTGTCGTTTAAAAAGTGCTCTGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36634
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012241 Essential Splice Site 245 867 7 22
ENSDART00000129688 Essential Splice Site 142 611 4 14
ENSDART00000132993   None 151 None 3
Genomic Location (Zv9):
Chromosome 18 (position 20234943)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20465166
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATCTATGACCTCCTAGAGGAGACCCCCTTTGACCCCATAAAGCCCAAG[T/A]AAGCTTAAGTTTGTCCTTTTTGTGTTGATTCATCATAAGAATTTTTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012241 Nonsense 561 867 15 22
ENSDART00000129688 Nonsense 458 611 12 14
ENSDART00000132993   None 151 None 3
Genomic Location (Zv9):
Chromosome 18 (position 20225016)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 20455239
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACATTCTCTCCAAGGAGAACGTCATCCAAGAGCAGCGTGGCAAACTT[G/T]GAGAAAAAGACAAAATGCTCCAAAACCAGAAGAACGAGATTGATCGCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link