lamp2

Ensembl ID:
ENSDARG00000014914
ZFIN ID:
ZDB-GENE-030729-9
Description:
lysosomal membrane glycoprotein 2 [Source:RefSeq peptide;Acc:NP_001013551]
Human Orthologue:
LAMP2
Human Description:
lysosomal-associated membrane protein 2 [Source:HGNC Symbol;Acc:6501]
Mouse Orthologue:
Lamp2
Mouse Description:
lysosomal-associated membrane protein 2 Gene [Source:MGI Symbol;Acc:MGI:96748]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42416 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42416
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013519 Nonsense 347 355 6 6
ENSDART00000124242 Nonsense 347 355 6 6
ENSDART00000132813   None 211 None 5
ENSDART00000140001   None 253 None 4
ENSDART00000147059   None 296 None 5

The following transcripts of ENSDARG00000014914 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34450902)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 33135602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGGTTTGATTTTCATTGTTGTGATTGCATACGTGATTGGTCGACGA[C/T]GAACCTATGTTGGATATCAGACACTGTAATGCAACAAATCACAGAATCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link