si:ch211-69i14.7

Ensembl ID:
ENSDARG00000014910
ZFIN ID:
ZDB-GENE-070705-192
Description:
hypothetical protein LOC567417 [Source:RefSeq peptide;Acc:NP_001093500]
Human Orthologue:
PANX1
Human Description:
pannexin 1 [Source:HGNC Symbol;Acc:8599]
Mouse Orthologue:
Panx1
Mouse Description:
pannexin 1 Gene [Source:MGI Symbol;Acc:MGI:1860055]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40513 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40513
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000097738 Nonsense 287 392 6 7
Genomic Location (Zv9):
Chromosome 5 (position 39448199)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 37247896
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGCAGTGGGTGTTTTCCGTCTTCTAAGCTGCATGAATCTGGTGGTGTA[T/A]TTACTGTTAGTGCCGGCTGTGGTTTATGCCGGCCTTCAGCCTGCCCGTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link