htra1b

Ensembl ID:
ENSDARG00000014907
ZFIN ID:
ZDB-GENE-080219-7
Description:
HtrA serine peptidase 1 [Source:RefSeq peptide;Acc:NP_001104652]
Human Orthologue:
HTRA1
Human Description:
HtrA serine peptidase 1 [Source:HGNC Symbol;Acc:9476]
Mouse Orthologue:
Htra1
Mouse Description:
HtrA serine peptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1929076]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12975 Nonsense Available for shipment Available now
sa27906 Nonsense Mutation detected in F1 DNA During 2016
sa24904 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22048 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12975
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012318 Nonsense 17 476 1 9
Genomic Location (Zv9):
Chromosome 12 (position 12563494)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11419147
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGCGTCTTTTGATTCTGTGCGCGTCTATTATTCTGGTACCGCTGCTGTG[C/A]GATGCGCGGATCATTAAGCGTTATGTGATCGGCTGTCCGGAGCGCTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27906
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012318 Nonsense 151 476 1 9
Genomic Location (Zv9):
Chromosome 12 (position 12563092)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11418745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCGCAGAAGCTTCAGCAGCCACCCATCATCTTCATCCAGAGAGGAGCCTG[C/A]GGGAAAGGTAAGAATTGACCTTTTACATTTCCAAGTTTTGACAAAATATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24904
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012318 Essential Splice Site 370 476 6 9
Genomic Location (Zv9):
Chromosome 12 (position 12507599)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11363252
KASP Assay ID:
554-7492.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACAAGATCCGACAGTTCCTGGCTGAGTCTCACGACAGGCAGGCTAAAGG[T/G]CAGCAGCAGCATTTAAAACTTAGAAACATCTAAGTCCTGTTATGACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22048
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012318 Essential Splice Site 389 476 8 9
Genomic Location (Zv9):
Chromosome 12 (position 12504142)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 11359795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCAAACAGACATGGCGTTTGTGTTTGTACTAAGAATCTGTTTCTCAT[A/T]GACTTGCTAAGGAGCTAAAGCAGAGAAAAAATGATTTCCCAGATGTCACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link