
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
CHD1
- Ensembl ID:
- ENSDARG00000014878
- Description:
- chromodomain helicase DNA binding protein 1 [Source:HGNC Symbol;Acc:1915]
- Human Orthologue:
- CHD1
- Human Description:
- chromodomain helicase DNA binding protein 1 [Source:HGNC Symbol;Acc:1915]
- Mouse Orthologue:
- Chd1
- Mouse Description:
- chromodomain helicase DNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:88393]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa34847 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa21667 | Nonsense | Available for shipment | Available now |
sa5826 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa34847
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085727 | Essential Splice Site | 587 | 1778 | 12 | 36 |
- Genomic Location (Zv9):
- Chromosome 10 (position 8541545)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 6567901 GRCz11 10 6569110 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAGTTGAACATTCTTCTGACTACATATGAAATTCTGCTGAAGGATAAG[G/T]TATAATTCAAGCCAAATTCATCTTTTAAAACACTGAGAAACTTATTTTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21667
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085727 | Nonsense | 846 | 1778 | 18 | 36 |
- Genomic Location (Zv9):
- Chromosome 10 (position 8551589)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 6557857 GRCz11 10 6559066 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAAACGTGAAATTTGTTGACGTGATTTCTTTGACTTTGCAGGATTTCTG[T/A]TTCCTGTTGTCCACACGAGCGGGTGGTCTGGGCATTAACCTGGCCTCTGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5826
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000085727 | Nonsense | 1577 | 1778 | 33 | 36 |
- Genomic Location (Zv9):
- Chromosome 10 (position 8579660)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 6529786 GRCz11 10 6530995 - KASP Assay ID:
- 554-3680.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AATTCGATGCAAGGAAACTGCATAAACTGTAYAAGCACGCTATYAAGAAA[C/T]GACAAGAAAATGCTCAGGTATGAACACATTATTATTTTTACATTTCTGTT
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: