CHD1

Ensembl ID:
ENSDARG00000014878
Description:
chromodomain helicase DNA binding protein 1 [Source:HGNC Symbol;Acc:1915]
Human Orthologue:
CHD1
Human Description:
chromodomain helicase DNA binding protein 1 [Source:HGNC Symbol;Acc:1915]
Mouse Orthologue:
Chd1
Mouse Description:
chromodomain helicase DNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:88393]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34847 Essential Splice Site Mutation detected in F1 DNA During 2016
sa21667 Nonsense Available for shipment Available now
sa5826 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa34847
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Essential Splice Site 587 1778 12 36
Genomic Location (Zv9):
Chromosome 10 (position 8541545)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6567901
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAGTTGAACATTCTTCTGACTACATATGAAATTCTGCTGAAGGATAAG[G/T]TATAATTCAAGCCAAATTCATCTTTTAAAACACTGAGAAACTTATTTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21667
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Nonsense 846 1778 18 36
Genomic Location (Zv9):
Chromosome 10 (position 8551589)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6557857
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAACGTGAAATTTGTTGACGTGATTTCTTTGACTTTGCAGGATTTCTG[T/A]TTCCTGTTGTCCACACGAGCGGGTGGTCTGGGCATTAACCTGGCCTCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5826
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000085727 Nonsense 1577 1778 33 36
Genomic Location (Zv9):
Chromosome 10 (position 8579660)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 6529786
KASP Assay ID:
554-3680.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTCGATGCAAGGAAACTGCATAAACTGTAYAAGCACGCTATYAAGAAA[C/T]GACAAGAAAATGCTCAGGTATGAACACATTATTATTTTTACATTTCTGTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link