CHD1

Ensembl ID:: ENSDARG00000014878
Description:: chromodomain helicase DNA binding protein 1 [Source:HGNC Symbol;Acc:1915]
Human Orthologue:: CHD1
Human Description:: chromodomain helicase DNA binding protein 1 [Source:HGNC Symbol;Acc:1915]
Mouse Orthologue:: Chd1
Mouse Description:: chromodomain helicase DNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:88393]

Alleles

There are 6 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa4361	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa3765	Nonsense	Mutation detected in F1 DNA	During 2015
sa21667	Nonsense	Mutation detected in F1 DNA	During 2015
sa2580	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa18978	Essential Splice Site	Mutation detected in F1 DNA	During 2015
sa5826	Nonsense	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa4361
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000085727	Essential Splice Site	587	1778	12	36

Genomic Location:: Chromosome 10 (position 8541546)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: GAAGTTGAACATTCTTCTGACTACATATGAAATTCTGCTGAAGGATAAGG[T/C]ATAATTCAAGCCAAATTCATCTTTTRAAACACTGAGAAACTTATTTTAAA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa3765
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000085727	Nonsense	711	1778	14	36

Genomic Location:: Chromosome 10 (position 8544582)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CTGCCAAGGTGGAACAGATCCTCCGGGTGGAGATGAGCGCGGTTCAGAAA[C/T]AATACTACAAGTAAGACAACCACATTCATATAGAMTACAGTACAGAGAGA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa21667
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000085727	Nonsense	846	1778	18	36

Genomic Location:: Chromosome 10 (position 8551589)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: GAAAACGTGAAATTTGTTGACGTGATTTCTTTGACTTTGCAGGATTTCTG[T/A]TTCCTGTTGTCCACACGAGCGGGTGGTCTGGGCATTAACCTGGCCTCTGC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa2580
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000085727	Essential Splice Site	1007	1778	21	36
ENSDART00000085727	Essential Splice Site	1007	1778	21	36

Genomic Location:: Chromosome 10 (position 8557413)
KASP Assay ID:: 2260-2910.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TGACCCAGGACCATCGACTGTAGGAGAAGAGCTGCTCTCACAGTTTAAGG[T/A]ATTTTCTGGCRTTTAAAACRTATTATTAATGATACGTTGGACTTTCAGTY
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa18978
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: T > A
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000085727	Essential Splice Site	1007	1778	21	36
ENSDART00000085727	Essential Splice Site	1007	1778	21	36

Genomic Location:: Chromosome 10 (position 8557413)
KASP Assay ID:: 2260-2910.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: TGACCCAGGACCATCGACTGTAGGAGAAGAGCTGCTCTCACAGTTTAAGG[T/A]ATTTTCTGGCATTTAAAACGTATTATTAATGATACGTTGGACTTTCAGTC
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa5826
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000085727	Nonsense	1577	1778	33	36

Genomic Location:: Chromosome 10 (position 8579660)
KASP Assay ID:: 554-3680.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: AATTCGATGCAAGGAAACTGCATAAACTGTAYAAGCACGCTATYAAGAAA[C/T]GACAAGAAAATGCTCAGGTATGAACACATTATTATTTTTACATTTCTGTT
Associated Phenotype:: Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

Renal sinus fat : Heritability and genome-wide association analysis of renal sinus fat accumulation in the Framingham Heart Study. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

OMIM

OMIM information for CHD1

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: