hprt1l

Ensembl ID:
ENSDARG00000014866
ZFIN ID:
ZDB-GENE-040625-17
Description:
hypoxanthine phosphoribosyltransferase 1, like [Source:RefSeq peptide;Acc:NP_001002056]
Human Orthologues:
HPRT1, PRTFDC1
Human Descriptions:
hypoxanthine phosphoribosyltransferase 1 [Source:HGNC Symbol;Acc:5157]
phosphoribosyl transferase domain containing 1 [Source:HGNC Symbol;Acc:23333]
Mouse Orthologue:
Hprt
Mouse Description:
hypoxanthine guanine phosphoribosyl transferase Gene [Source:MGI Symbol;Acc:MGI:96217]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12442 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12442
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025494 Nonsense 120 215 4 9
ENSDART00000114508 Nonsense 120 217 4 8
Genomic Location:
Chromosome 25 (position 38105229)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAATGACCAGTCCACCAACTGTGTGAAGGTGATCGGRGGAGACGAGCTAT[C/A]GGCCCTCGCTGGAAAAGTCAGTCTGGAGTTTGTTKGTTTTGGGWTGTGCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/h1hsn8eo