igfbp3

Ensembl ID:
ENSDARG00000014859
ZFIN ID:
ZDB-GENE-040412-1
Description:
insulin-like growth factor-binding protein 3 [Source:RefSeq peptide;Acc:NP_991314]
Human Orthologue:
IGFBP3
Human Description:
insulin-like growth factor binding protein 3 [Source:HGNC Symbol;Acc:5472]
Mouse Orthologue:
Igfbp3
Mouse Description:
insulin-like growth factor binding protein 3 Gene [Source:MGI Symbol;Acc:MGI:96438]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23636 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23636
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020400 Essential Splice Site 253 292 3 4
ENSDART00000144827 Essential Splice Site 149 188 3 4
Genomic Location (Zv9):
Chromosome 20 (position 7050498)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 6801771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCGCATTCCAAACTGTGACCAAAAGGGTTTCTACAAGAAAAAACAGG[T/C]AATTACATTTTACCTAAGCGCTTTGACTTTTTTTTGGCAGATGCTTTTTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link