LOC799901

Ensembl ID:
ENSDARG00000014854
Human Orthologue:
REEP1
Human Description:
receptor accessory protein 1 [Source:HGNC Symbol;Acc:25786]
Mouse Orthologue:
Reep1
Mouse Description:
receptor accessory protein 1 Gene [Source:MGI Symbol;Acc:MGI:1098827]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23162 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa23162
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000023953 Essential Splice Site 11 199 1 8
Genomic Location:
Chromosome 17 (position 43531256)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGCTCTCACAGCGCAATGGTCTCCTGGATTATTTCTAGGCTTGTGGTG[T/C]AAGTCATTATTCTACTCTTGTAAAGCATGTTCATAGAGATAAATAAGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zvxxain0