prph2b

Ensembl ID:
ENSDARG00000014840
ZFIN ID:
ZDB-GENE-000616-9
Description:
peripherin 2b (retinal degeneration, slow) [Source:RefSeq peptide;Acc:NP_571642]
Human Orthologue:
PRPH2
Human Description:
peripherin 2 (retinal degeneration, slow) [Source:HGNC Symbol;Acc:9942]
Mouse Orthologue:
Prph2
Mouse Description:
peripherin 2 Gene [Source:MGI Symbol;Acc:MGI:102791]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42120 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa42120
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020671 Nonsense 179 342 1 3
Genomic Location (Zv9):
Chromosome 13 (position 2943065)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 3120484
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCGCTGCTGTGGCAACAACAACTACAAGGATTGGTTTGAGATCCAGTG[G/A]ATTAGCAACCGTTACTTGGACTTCAGCAATGATGAAATTAAAGAGTAAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link