ptplb

Ensembl ID:
ENSDARG00000014806
ZFIN ID:
ZDB-GENE-030131-6053
Description:
protein-tyrosine phosphatase-like member B [Source:RefSeq peptide;Acc:NP_956155]
Human Orthologue:
PTPLB
Human Description:
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b [Source:HGNC Sym
Mouse Orthologue:
Ptplb
Mouse Description:
protein tyrosine phosphatase-like (proline instead of catalytic arginine), member b Gene [Source:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41481 Nonsense Mutation detected in F1 DNA During 2017
sa13302 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa41481
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015532 Nonsense 116 239 5 7
ENSDART00000133998 Nonsense 121 244 5 7
ENSDART00000134574 Nonsense 50 173 3 5
ENSDART00000141998 Nonsense 117 216 5 6
Genomic Location (Zv9):
Chromosome 9 (position 39085985)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38223881
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTATGTAGTCTCTGGGTGACTTAAATCTCTCATTTCAGGTCCAGAGT[G/T]AAGACAGTGTTCTCCTCTTTGTGGTGGCCTGGACAGTCACTGAGATCATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13302
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015532 Essential Splice Site 213 239 None 7
ENSDART00000133998 Essential Splice Site 218 244 None 7
ENSDART00000134574 Essential Splice Site 147 173 None 5
ENSDART00000141998   214 216 6 6
Genomic Location (Zv9):
Chromosome 9 (position 39085564)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 38223460
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCGACTACCACACGTTCCTCATCTTCGTCAKGATCTCCTACATACCCTG[T/C]ACGTATTAACTTGTGCWCTAAGWCATCACGGGCCAGATTTAYTGAAAWAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link