cacna2d1a

Ensembl ID:
ENSDARG00000014804
ZFIN ID:
ZDB-GENE-041210-215
Description:
voltage-dependent calcium channel subunit alpha-2/delta-1 [Source:RefSeq peptide;Acc:NP_001038425]
Human Orthologue:
CACNA2D1
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 1 [Source:HGNC Symbol;Acc:1399]
Mouse Orthologue:
Cacna2d1
Mouse Description:
calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6941 Essential Splice Site Mutation detected in F1 DNA During 2014
sa7551 Missense Mutation detected in F1 DNA During 2014
sa3472 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8955 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6941
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Essential Splice Site 36 1069 2 38
ENSDART00000105967 Essential Splice Site 36 1090 2 39
Genomic Location:
Chromosome 4 (position 18790033)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CKTTTGACTGTTGTTCAWCACTGATCATGTGATTTGCCCTTCATGTTTGC[A/T]GGACCCGGAAATGGGCAGAAAAGATGCAGGAAGATCTCGTGCAGTTGATY
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7551
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Missense 289 1069 10 38
ENSDART00000105967 Missense 289 1090 10 39
Genomic Location:
Chromosome 4 (position 18743703)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCAGKCAGCGAGATGCTGGAGACTCTCTCAGATGACGATTACKTCAACA[T/C]CGTCTCTGTGAGTATACAGGAGATGAKCGACTTCCGCAAAACTGACTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3472
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Essential Splice Site 554 1069 19 38
ENSDART00000105967 Essential Splice Site 556 1090 19 39
Genomic Location:
Chromosome 4 (position 18735747)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGACGCTGGACTTCTTGGATGCTGAGATGGAGGATGAAGTCAAAGTGGAT[G/A]TGAGAAYAAAACAAATGTATTAATGTTGACTTGATCTACTAATATTTCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8955
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014440 Nonsense 876 1069 32 38
ENSDART00000105967 Nonsense 885 1090 33 39
Genomic Location:
Chromosome 4 (position 18712362)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAATGAGAAATCTGATGAACGTGTCCCTGTTYTCMGTCAACATAACCTA[C/A]GACTACCAGGCYCTTTGCGAACCCACCAGAGAATCTAAAGCTGCCGCTGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/3apaut0d