lrrc4bb

Ensembl ID:
ENSDARG00000014792
ZFIN ID:
ZDB-GENE-091116-44
Human Orthologue:
LRRC4B
Human Description:
leucine rich repeat containing 4B [Source:HGNC Symbol;Acc:25042]
Mouse Orthologue:
Lrrc4b
Mouse Description:
leucine rich repeat containing 4B Gene [Source:MGI Symbol;Acc:MGI:3027390]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6782 Nonsense Mutation detected in F1 DNA During 2014
sa5086 Nonsense Mutation detected in F1 DNA During 2014
sa12009 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007208 Nonsense 78 745 1 2
ENSDART00000140739 Nonsense 59 643 4 6

The following transcripts of ENSDARG00000014792 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 39866615)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTAGCTGTTCGAATCAAGCCAGTCGAGTGATCTGTACCAAAAAAAGCT[T/G]AAATGAAGTTCCACAGAGCATCTCGTCCAATACTCGATACCTYAACCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5086
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007208 Nonsense 260 745 2 2
ENSDART00000140739 Nonsense 241 643 5 6

The following transcripts of ENSDARG00000014792 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 39864803)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGTGCGTCCTGGATCGTTTCAAGGCCTGGTGTCTCTGCGCAAACTGTG[G/A]CTCATGCACTCTMGGATCTCGGTCATTGAGAGGAATGCATTTGATRACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007208 Nonsense 641 745 2 2
ENSDART00000140739 Nonsense 622 643 5 6

The following transcripts of ENSDARG00000014792 do not overlap with this mutation:

Genomic Location:
Chromosome 24 (position 39863662)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGARTCCGAGAATTCATGAYCCTGAGATCATGACCCTGCCAAGCGTTGGG[C/T]AAGCMGACCACCTGAACCACTACTACAAAGCGCACCACTTTAACAACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ckvtibr7