lrrc4bb

Ensembl ID:
ENSDARG00000014792
ZFIN ID:
ZDB-GENE-091116-44
Human Orthologue:
LRRC4B
Human Description:
leucine rich repeat containing 4B [Source:HGNC Symbol;Acc:25042]
Mouse Orthologue:
Lrrc4b
Mouse Description:
leucine rich repeat containing 4B Gene [Source:MGI Symbol;Acc:MGI:3027390]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6782 Nonsense Mutation detected in F1 DNA During 2016
sa12009 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6782
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007208 Nonsense 78 745 1 2
ENSDART00000140739 Nonsense 59 643 4 6

The following transcripts of ENSDARG00000014792 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 39866615)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38484750
KASP Assay ID:
554-5152.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTAGCTGTTCGAATCAAGCCAGTCGAGTGATCTGTACCAAAAAAAGCT[T/G]AAATGAAGTTCCACAGAGCATCTCGTCCAATACTCGATACCTYAACCTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12009
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007208 Nonsense 641 745 2 2
ENSDART00000140739 Nonsense 622 643 5 6

The following transcripts of ENSDARG00000014792 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 24 (position 39863662)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 38481797
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGARTCCGAGAATTCATGAYCCTGAGATCATGACCCTGCCAAGCGTTGGG[C/T]AAGCMGACCACCTGAACCACTACTACAAAGCGCACCACTTTAACAACAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link