usp4

Ensembl ID:
ENSDARG00000014770
ZFIN ID:
ZDB-GENE-041008-187
Human Orthologue:
USP4
Human Description:
ubiquitin specific peptidase 4 (proto-oncogene) [Source:HGNC Symbol;Acc:12627]
Mouse Orthologue:
Usp4
Mouse Description:
ubiquitin specific peptidase 4 (proto-oncogene) Gene [Source:MGI Symbol;Acc:MGI:98905]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12557 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12557
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000039868 Nonsense 923 1009 20 22
Genomic Location:
Chromosome 6 (position 42279573)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTAAACATGTCAGAGTTTGTGTGTGACCCCAAAGCTGACCCATACATCTA[C/A]GACCTCATTGCTGTTTCMAACCATTATGGAGGAATGGGCGGAGGCCACTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/mgvnk10v