rbfox1

Ensembl ID:
ENSDARG00000014746
ZFIN ID:
ZDB-GENE-040927-11
Description:
Fox-1 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q642J5]
Human Orthologue:
RBFOX1
Human Description:
RNA binding protein, fox-1 homolog (C. elegans) 1 [Source:HGNC Symbol;Acc:18222]
Mouse Orthologue:
Rbfox1
Mouse Description:
RNA binding protein, fox-1 homolog (C. elegans) 1 Gene [Source:MGI Symbol;Acc:MGI:1926224]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15940 Essential Splice Site Available for shipment Available now
sa15281 Essential Splice Site Available for shipment Available now
sa2130 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa15940
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122037 Essential Splice Site 12 373 2 12

The following transcripts of ENSDARG00000014746 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 28219448)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAAAACTAYCCAGGCAGTCATTTGACCATTTTTGAAATGTTGTTTTTTTNC[A/T]GGGTAAWCAAGACGCCCCAGCACCCCCAGAAACCATGGCCCAGCCTTTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15281
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122037 Essential Splice Site 210 373 6 12

The following transcripts of ENSDARG00000014746 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 28193032)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACAGCACGGGTAATGACGAATAAAAAGACAGTCAACCCATATGCAAATGG[T/A]AAGAACAAGCTCCCTTGATGTTGTCGAATGCATAMGAGTATAGATTGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2130
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122037 Essential Splice Site 210 373 7 12

The following transcripts of ENSDARG00000014746 do not overlap with this mutation:

Genomic Location:
Chromosome 3 (position 28190709)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTASAGTTTTAGTTTGCTAATATCAGATCTCTTGCTCTCTGTGTTTGTCT[A/G]GGCTGGAAGTTGAATCCAGTCGTGGGTGCAGTCTACAGCCCAGAATTCTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Obesity-related traits: Novel genetic loci identified for the pathophysiology of childhood obesity in the Hispanic population. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • Refractive error: Meta-analysis of genome-wide association studies in five cohorts reveals common variants in RBFOX1, a regulator of tissue-specific splicing, associated with refractive error. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jthf606p