acox1

Ensembl ID:
ENSDARG00000014727
ZFIN ID:
ZDB-GENE-041010-219
Description:
peroxisomal acyl-coenzyme A oxidase 1 [Source:RefSeq peptide;Acc:NP_001005933]
Human Orthologue:
ACOX1
Human Description:
acyl-CoA oxidase 1, palmitoyl [Source:HGNC Symbol;Acc:119]
Mouse Orthologue:
Acox1
Mouse Description:
acyl-Coenzyme A oxidase 1, palmitoyl Gene [Source:MGI Symbol;Acc:MGI:1330812]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5364 Nonsense F2 line generated During 2014
sa16860 Nonsense Available for shipment Available now
sa13596 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5364
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049226 Nonsense 42 660 2 14
ENSDART00000067560 Nonsense 42 660 2 14

The following transcripts of ENSDARG00000014727 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 21709589)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATCTGTTTTTTTGTTTTGTTTGNTTTTTTTCTAGAGTCTCTGGTTATT[G/T]GAGATCCAGATTTCCAACATGAAGACCTAAACTTTCTCTCTCGAAGTGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16860
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049226 Nonsense 136 660 3 14
ENSDART00000067560 None None 660 None 14

The following transcripts of ENSDARG00000014727 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 21710594)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCAAAAAATGGATCCCMTTAGCTGAGTCATTCCAWATGTTAGGCACCTA[T/A]GCTCAGACAGAGCTGGGGCACGGTCAGTTCTTCTCTCCTGAACAATTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13596
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000049226 Nonsense 589 660 13 14
ENSDART00000067560 Nonsense 589 660 13 14

The following transcripts of ENSDARG00000014727 do not overlap with this mutation:

Genomic Location:
Chromosome 6 (position 21723646)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCTTTCTCAGGCTGGTCTGCTAAGTGTTTCTCAGCTGGATCAGATTTCA[C/T]AGAGGCTGAAGGGTCTCCTCTTAGAGATAAGGCCCAATGCAGTGGCTCTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/jbis2ki8