her1

Ensembl ID:
ENSDARG00000014722
ZFIN ID:
ZDB-GENE-980526-125
Description:
transcription factor HES-7 [Source:RefSeq peptide;Acc:NP_571153]
Human Orthologue:
HES7
Human Description:
hairy and enhancer of split 7 (Drosophila) [Source:HGNC Symbol;Acc:15977]
Mouse Orthologue:
Hes7
Mouse Description:
hairy and enhancer of split 7 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2135679]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa40604 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa40604
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016307 Nonsense 44 328 2 4
ENSDART00000121426 Nonsense 44 67 3 5
Genomic Location (Zv9):
Chromosome 5 (position 71699267)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 68023885
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATCAACCAGCGTTTGGAAGAACTGCGAACGCTTCTTCTGGATAATACTT[T/A]AGATTCGGTAATAAAACATATAAAGTTTTAAAAGTGCACTTAAACAACAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link