DYNC1H1

Ensembl ID:
ENSDARG00000014717
Description:
dynein, cytoplasmic 1, heavy chain 1 [Source:HGNC Symbol;Acc:2961]
Human Orthologue:
DYNC1H1
Human Description:
dynein, cytoplasmic 1, heavy chain 1 [Source:HGNC Symbol;Acc:2961]
Mouse Orthologue:
Dync1h1
Mouse Description:
dynein cytoplasmic 1 heavy chain 1 Gene [Source:MGI Symbol;Acc:MGI:103147]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19157 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9468 Essential Splice Site Available for shipment Available now
sa30693 Nonsense Mutation detected in F1 DNA During 2018
sa42841 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42840 Essential Splice Site Mutation detected in F1 DNA During 2018
sa44865 Essential Splice Site Mutation detected in F1 DNA During 2018
sa42839 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45588 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19157
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034216 Essential Splice Site 1993 4548 39 98
ENSDART00000034216 Essential Splice Site 1993 4548 39 98
Genomic Location (Zv9):
Chromosome 17 (position 214358)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1568748
GRCz11 17 913198
KASP Assay ID:
2261-0451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCCTTGCGTGTTGTTGACGTGTTAATGATTGCACGTGTGTGTTGTGCA[G/T]GTGTGCCCGTCACCACCGAGCTGCTGAATAAGCAGGTGAAGGTGAGTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9468
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034216 Essential Splice Site 1993 4548 39 98
ENSDART00000034216 Essential Splice Site 1993 4548 39 98
Genomic Location (Zv9):
Chromosome 17 (position 214358)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1568748
GRCz11 17 913198
KASP Assay ID:
2261-0451.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TKTCCTTGCGTGTTGTTGACGTGTTAATGATTGCACRTGTGTGTTGTKCA[G/T]GTGTGCCCGTCACCACYGAGCTGCTGAATAAGCAGGTGAAGGTGAGTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30693
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034216 Nonsense 2545 4548 48 98
Genomic Location (Zv9):
Chromosome 17 (position 205213)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1559603
GRCz11 17 904053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCGTGTGTGTGTGTGTGTCCTGTGCAGGTGTCCATCACGGGCGAGTGG[C/T]AGTCCTGGCAGGGGAAGGTGCCCCAGATCGAGGTGGAGACCCATAAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42841
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034216 Essential Splice Site 2780 4548 51 98
Genomic Location (Zv9):
Chromosome 17 (position 203464)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1557854
GRCz11 17 902304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCGAGCCGCTCACCGCCGCCATGGTGGAGTTCTACACCATGTCTCAGG[T/C]GCGCAGACACAGAGCTGAACACAGAGTCTGCTATGAGCACAGCACAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034216 Essential Splice Site 2888 4548 54 98
Genomic Location (Zv9):
Chromosome 17 (position 202353)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1556743
GRCz11 17 901193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGCGGTAATGATGAGACGTCTGTAATGATCAAGCGGTAATGACAAGACT[G/A]TAGGGTCGAAACTGAAGTGACGATAACTCATTAACAACTAGATAAGGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44865
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034216 Essential Splice Site 2897 4548 54 98
Genomic Location (Zv9):
Chromosome 17 (position 202325)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1556715
GRCz11 17 901165
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCAAGCGGTAATGACAAGACTGTAGGGTCGAAACTGAAGTGACGATAAC[T/C]CATTAACAACTAGATAAGGTTTTAATAAGGCGTTAATGGTGCAATTGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034216 Essential Splice Site 2920 4548 56 98
Genomic Location (Zv9):
Chromosome 17 (position 202213)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1556603
GRCz11 17 901053
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAACAACAAGATGTTATCATCATCTGGTTATTAACATGTCAGTGTTTGTC[G/T]TCTCATTTTTGCCATCTCATTATCATCTGGTTATAAACAAGTCGTTAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45588
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034216 Nonsense 3492 4548 77 98
Genomic Location (Zv9):
Chromosome 17 (position 188009)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1542399
GRCz11 17 886849
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGGAGAAGACCAGCGAGACCTTCAAGAACCAGATGTCCACCATCGCC[G/T]GAGACTGCCTGCTGTCCGCCGCCTTCATCGCCTACGCCGGCTACTTCGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link