esco2

Ensembl ID:
ENSDARG00000014685
ZFIN ID:
ZDB-GENE-050913-156
Description:
N-acetyltransferase ESCO2 [Source:UniProtKB/Swiss-Prot;Acc:Q5SPR8]
Human Orthologue:
ESCO2
Human Description:
establishment of cohesion 1 homolog 2 (S. cerevisiae) [Source:HGNC Symbol;Acc:27230]
Mouse Orthologue:
Esco2
Mouse Description:
establishment of cohesion 1 homolog 2 (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919238]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14007 Essential Splice Site Available for shipment Available now
sa16629 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14007
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009164 Essential Splice Site 426 609 7 11
ENSDART00000009164 Essential Splice Site 426 609 7 11
Genomic Location:
Chromosome 20 (position 39374541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACACACACAGTTCCATCAGCGCTTTCTGGACACMATTAAGTTTGTGG[T/A]KAGCCATCATGATGTTTATTARTATTACAACAGATCGTATATTGGATACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009164 Essential Splice Site 426 609 7 11
ENSDART00000009164 Essential Splice Site 426 609 7 11
Genomic Location:
Chromosome 20 (position 39374541)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAACACACACAGTTCCATCAGCGCTTTCTGGACACMATTAAGTTTGTGG[T/A]KAGCCATCATGATGTTTATTAATATTACAACAGATCGTATATTGGATASA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tb5d0hqw