efna3a

Ensembl ID:
ENSDARG00000014675
ZFIN ID:
ZDB-GENE-060503-186
Description:
Novel protein similar to ephrin A3 (Efna3) [Source:UniProtKB/TrEMBL;Acc:Q1LWM6]
Human Orthologues:
EFNA3, RP11-540D14.8
Human Descriptions:
cDNA FLJ57652, highly similar to Ephrin-A3 [Source:UniProtKB/TrEMBL;Acc:B4DXG7]
ephrin-A3 [Source:HGNC Symbol;Acc:3223]
Mouse Orthologue:
Efna3
Mouse Description:
ephrin A3 Gene [Source:MGI Symbol;Acc:MGI:106644]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18620 Nonsense Available for shipment Available now
sa39230 Essential Splice Site Mutation detected in F1 DNA During 2016
sa36781 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027274 Nonsense 119 220 2 5
ENSDART00000147218 Nonsense 83 180 1 4
Genomic Location (Zv9):
Chromosome 19 (position 8938005)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8396544
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACACGCCCCCCACGCACCCATTAAATTCTCTGAGAAATTCCAACGTTA[C/A]AGCGCCTTYTCACTAGGCTATGAGTTCAACGTRGGACATGAGTACTATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39230
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027274 Essential Splice Site 138 220 2 5
ENSDART00000147218 Essential Splice Site 102 180 1 4
Genomic Location (Zv9):
Chromosome 19 (position 8938062)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8396601
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCACTAGGCTATGAGTTCAACGTGGGACATGAGTACTATTATATATG[T/A]GAGTATTCAGTTCTTGTGTAAGATTTCAACTAAAAGAAGATATGCTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36781
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027274 Nonsense 187 220 5 5
ENSDART00000147218 Nonsense 147 180 4 4
Genomic Location (Zv9):
Chromosome 19 (position 8958480)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 8417019
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCTTTCTTTGCTTTTTTTCTTCCTCTTGTCTCAGACGAGTTTAACCCT[G/T]AGATCCCCAAACTGGAGAAGAGTGTAAGCGGCAGCAGTCCGTCCGGAGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link