efna3a

Ensembl ID:
ENSDARG00000014675
ZFIN ID:
ZDB-GENE-060503-186
Description:
Novel protein similar to ephrin A3 (Efna3) [Source:UniProtKB/TrEMBL;Acc:Q1LWM6]
Human Orthologues:
EFNA3, RP11-540D14.8
Human Descriptions:
cDNA FLJ57652, highly similar to Ephrin-A3 [Source:UniProtKB/TrEMBL;Acc:B4DXG7]
ephrin-A3 [Source:HGNC Symbol;Acc:3223]
Mouse Orthologue:
Efna3
Mouse Description:
ephrin A3 Gene [Source:MGI Symbol;Acc:MGI:106644]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18620 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18620
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027274 Nonsense 119 220 2 5
ENSDART00000147218 Nonsense 83 180 1 4
Genomic Location:
Chromosome 19 (position 8938005)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACACGCCCCCCACGCACCCATTAAATTCTCTGAGAAATTCCAACGTTA[C/A]AGCGCCTTYTCACTAGGCTATGAGTTCAACGTRGGACATGAGTACTATTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/skl2egft