acsl3b

Ensembl ID:
ENSDARG00000014674
ZFIN ID:
ZDB-GENE-030131-492
Description:
Novel protein similar to H.sapiens ACSL3, acyl-CoA synthetase long-chain family member 3 (ACSL3) [So
Human Orthologue:
ACSL3
Human Description:
acyl-CoA synthetase long-chain family member 3 [Source:HGNC Symbol;Acc:3570]
Mouse Orthologue:
Acsl3
Mouse Description:
acyl-CoA synthetase long-chain family member 3 Gene [Source:MGI Symbol;Acc:MGI:1921455]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2049 Essential Splice Site F2 line generated During 2014
sa15610 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa2049
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074968 Essential Splice Site 434 723 10 16
ENSDART00000141974 Essential Splice Site 422 711 11 17
Genomic Location:
Chromosome 2 (position 47509032)
KASP Assay ID:
554-2998.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACAAAATGGAGCAGATCTCCAAAGGATACACCACACCGCTYTGCGACAG[G/A]TACAACGCAATGCTMAATATRATATTAAAGAGCTCTATATAGTTTTTTNA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15610
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000074968 Essential Splice Site 581 723 14 16
ENSDART00000141974 Essential Splice Site 569 711 15 17
Genomic Location:
Chromosome 2 (position 47501368)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAAGTCATTTCTACACAATWTTTACTAATTAATTGTGACNTCTGTGTGT[A/T]GATCGAAAGAAGGACCTAGTGAAGTTGCAARCTGGTGAATATGTGTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/g4sqer64