glt25d2

Ensembl ID:
ENSDARG00000014670
ZFIN ID:
ZDB-GENE-070222-1
Description:
procollagen galactosyltransferase 2 [Source:RefSeq peptide;Acc:NP_001123548]
Human Orthologue:
GLT25D2
Human Description:
glycosyltransferase 25 domain containing 2 [Source:HGNC Symbol;Acc:16790]
Mouse Orthologue:
Glt25d2
Mouse Description:
glycosyltransferase 25 domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2138232]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34369 Nonsense Mutation detected in F1 DNA During 2017
sa38683 Nonsense Mutation detected in F1 DNA During 2017
sa21257 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34369
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014183 Nonsense 385 613 9 12
Genomic Location (Zv9):
Chromosome 8 (position 19893746)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19338384
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGAACACATCTCAGCTTCAAGCTCTTGGTATAGAAATGATGCCAGGGTA[T/G]AAAGATCCGTATTCTGGTCGAGTTTTGACACGTGGAGAGATCGGCTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38683
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014183 Nonsense 401 613 9 12
Genomic Location (Zv9):
Chromosome 8 (position 19893698)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19338336
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATAAAGATCCGTATTCTGGTCGAGTTTTGACACGTGGAGAGATCGGCTG[T/A]TTCCTCAGTCACCACTTCACCTGGAAACAGGTACACACACACTCATGAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21257
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014183 Essential Splice Site 411 613 9 12
Genomic Location (Zv9):
Chromosome 8 (position 19893666)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 19338304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGTGGAGAGATCGGCTGTTTCCTCAGTCACCACTTCACCTGGAAACAGG[T/C]ACACACACACTCATGAATAGATATGCTGCACTTTACATTAAAAATGGCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link