ITPR1 (2 of 2)

Ensembl ID:
ENSDARG00000014655
Description:
inositol 1,4,5-triphosphate receptor, type 1 [Source:HGNC Symbol;Acc:6180]
Human Orthologue:
ITPR1
Human Description:
inositol 1,4,5-triphosphate receptor, type 1 [Source:HGNC Symbol;Acc:6180]
Mouse Orthologue:
Itpr1
Mouse Description:
inositol 1,4,5-triphosphate receptor 1 Gene [Source:MGI Symbol;Acc:MGI:96623]

Alleles

There are 9 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9229 Essential Splice Site Mutation detected in F1 DNA During 2014
sa20768 Nonsense Available for shipment Available now
sa20769 Nonsense Available for shipment Available now
sa7044 Nonsense Mutation detected in F1 DNA During 2014
sa2334 Nonsense Mutation detected in F1 DNA During 2014
sa20770 Nonsense Available for shipment Available now
sa10338 Nonsense Available for shipment Available now
sa1340 Nonsense Available for shipment Available now
sa2315 Essential Splice Site F2 line generated During 2014

Mutation Details

Allele Name:
sa9229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Essential Splice Site 733 2727 20 64
Genomic Location:
Chromosome 6 (position 39882253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAAAAGATGGACATACAGAGGACCAGGAAGTCATCAATTATTACAGG[T/A]AAGGACAAAAACACCTACTTGTAAATAGGATGGAGTGATGMGGAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 781 2727 21 64
Genomic Location:
Chromosome 6 (position 39883458)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGCATGTCAGATGAAGATTTGCCCTTTGACCTCAGAGCATCGTTCTG[C/A]CGCATGATGCTGCACATGCATGTAGACCGTGACCCTCAGGAGCAGGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1255 2727 31 64
Genomic Location:
Chromosome 6 (position 39890704)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCAAAACTTCTGTGCTGGAAATCAGCAGAACCAGGCACTTCTACAC[A/T]AACACATCAACCTGTTCCTCAACCCTGGGGTAAGAACACACAAACATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1371 2727 34 64
Genomic Location:
Chromosome 6 (position 39892786)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCRKACTTGTTGTTGTCATTATAAGACTTCATGCTSACTCTTACAGGTA[T/A]CACATTCAYCTGGTGGAGTTGCTGGCTGTGTGCACTGAAGGCAAGAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2334
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1521 2727 37 64
Genomic Location:
Chromosome 6 (position 39894854)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGTTTGTGCAGCTRCWGCAGGGAGTGTTTCGTGTATATCACTGCAACT[G/A]GCTTCTCCCAGGTCAGAAGGGGAATGTGGAAGCCTGCATCAAAGTGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1779 2727 43 64
Genomic Location:
Chromosome 6 (position 39902956)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGTGTTCGTTTGATTTCAGGGGGGTTGAGCAGGGCTGAGATGTCAT[T/A]AATGGAGGTGCAGTGTCATCTAGACCGTGAAGGGGCATCGGATCTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1885 2727 44 64
Genomic Location:
Chromosome 6 (position 39904668)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTYGGCAACAAGCGGCGTGACGACAACACTCCAGACAAAGATACTCCA[C/T]AACGCCGCAGAGGTCTNGACTGGCAGTKTTTRATTAGCTCTGAGCAGATR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1985 2727 46 64
Genomic Location:
Chromosome 6 (position 39906614)
KASP Assay ID:
554-1254.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTTCCCCACAGAATTTTCTGCGCTGTCAGAACAATAAAAACAACTA[T/G]AAYCTGGTGTGTGAGACGCTGCAGTTCCTGGACTGTATCTGTGGCAGCAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa2315
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Essential Splice Site 2184 2727 50 64
Genomic Location:
Chromosome 6 (position 39909716)
KASP Assay ID:
554-3164.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGACCAGGMCCTGGAGTATTACACAAAACACACCTCACAGATAGAGG[T/C]AGYACAAACACCTTTAACTGATCAAMYTTTTAAAGTCCACTCTTTACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/82mekfgs