ITPR1 (2 of 2)

Ensembl ID:
ENSDARG00000014655
Description:
inositol 1,4,5-triphosphate receptor, type 1 [Source:HGNC Symbol;Acc:6180]
Human Orthologue:
ITPR1
Human Description:
inositol 1,4,5-triphosphate receptor, type 1 [Source:HGNC Symbol;Acc:6180]
Mouse Orthologue:
Itpr1
Mouse Description:
inositol 1,4,5-triphosphate receptor 1 Gene [Source:MGI Symbol;Acc:MGI:96623]

Alleles

There are 10 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9229 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20768 Nonsense Available for shipment Available now
sa40754 Nonsense Mutation detected in F1 DNA During 2016
sa20769 Nonsense Available for shipment Available now
sa7044 Nonsense Mutation detected in F1 DNA During 2016
sa20770 Nonsense Available for shipment Available now
sa10338 Nonsense Available for shipment Available now
sa1340 Nonsense Available for shipment Available now
sa38569 Nonsense Mutation detected in F1 DNA During 2016
sa2315 Essential Splice Site F2 line generated During 2016

Mutation Details

Allele Name:
sa9229
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Essential Splice Site 733 2727 20 64
Genomic Location (Zv9):
Chromosome 6 (position 39882253)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39953853
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACGCAAAAGATGGACATACAGAGGACCAGGAAGTCATCAATTATTACAGG[T/A]AAGGACAAAAACACCTACTTGTAAATAGGATGGAGTGATGMGGAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20768
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 781 2727 21 64
Genomic Location (Zv9):
Chromosome 6 (position 39883458)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39955058
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCTGCATGTCAGATGAAGATTTGCCCTTTGACCTCAGAGCATCGTTCTG[C/A]CGCATGATGCTGCACATGCATGTAGACCGTGACCCTCAGGAGCAGGTCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40754
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1220 2727 30 64
Genomic Location (Zv9):
Chromosome 6 (position 39890144)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39961744
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGAACATGGGAGCTCACAGTGTGGTCCTCGAACTGTTGCAAATCCCTTA[T/A]GAGAAGGTGCGGGTCAGCCATTGGAGGAATACATTTGGAAAATTATTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20769
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1255 2727 31 64
Genomic Location (Zv9):
Chromosome 6 (position 39890704)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39962304
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTTCAAAACTTCTGTGCTGGAAATCAGCAGAACCAGGCACTTCTACAC[A/T]AACACATCAACCTGTTCCTCAACCCTGGGGTAAGAACACACAAACATACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7044
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1371 2727 34 64
Genomic Location (Zv9):
Chromosome 6 (position 39892786)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39964386
KASP Assay ID:
554-5078.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCRKACTTGTTGTTGTCATTATAAGACTTCATGCTSACTCTTACAGGTA[T/A]CACATTCAYCTGGTGGAGTTGCTGGCTGTGTGCACTGAAGGCAAGAACGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20770
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1779 2727 43 64
Genomic Location (Zv9):
Chromosome 6 (position 39902956)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39974556
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATGTGTGTTCGTTTGATTTCAGGGGGGTTGAGCAGGGCTGAGATGTCAT[T/A]AATGGAGGTGCAGTGTCATCTAGACCGTGAAGGGGCATCGGATCTTGTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10338
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1885 2727 44 64
Genomic Location (Zv9):
Chromosome 6 (position 39904668)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39976268
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACCTYGGCAACAAGCGGCGTGACGACAACACTCCAGACAAAGATACTCCA[C/T]AACGCCGCAGAGGTCTNGACTGGCAGTKTTTRATTAGCTCTGAGCAGATR
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1340
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 1985 2727 46 64
Genomic Location (Zv9):
Chromosome 6 (position 39906614)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39978214
KASP Assay ID:
554-1254.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTTTTCCCCACAGAATTTTCTGCGCTGTCAGAACAATAAAAACAACTA[T/G]AAYCTGGTGTGTGAGACGCTGCAGTTCCTGGACTGTATCTGTGGCAGCAC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa38569
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Nonsense 2129 2727 49 64
Genomic Location (Zv9):
Chromosome 6 (position 39907648)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39979248
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGAAAATGGCCTACCAGCAGGGGGAGGCAGAGTTTGAGGATGAGGAA[C/T]AGGAGAATGGAGAGGATCATGCAGCATCGCCTCGCAATGTTGGACACAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2315
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000065092 Essential Splice Site 2184 2727 50 64
Genomic Location (Zv9):
Chromosome 6 (position 39909716)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 39981316
KASP Assay ID:
554-3164.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGGACCAGGMCCTGGAGTATTACACAAAACACACCTCACAGATAGAGG[T/C]AGYACAAACACCTTTAACTGATCAAMYTTTTAAAGTCCACTCTTTACATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link