ANKRD13B

Ensembl ID:
ENSDARG00000014652
Description:
ankyrin repeat domain 13B [Source:HGNC Symbol;Acc:26363]
Human Orthologue:
ANKRD13B
Human Description:
ankyrin repeat domain 13B [Source:HGNC Symbol;Acc:26363]
Mouse Orthologue:
Ankrd13b
Mouse Description:
ankyrin repeat domain 13b Gene [Source:MGI Symbol;Acc:MGI:2144501]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14927 Nonsense Available for shipment Available now
sa22662 Nonsense Mutation detected in F1 DNA During 2014
sa10858 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015286 Nonsense 42 632 2 15
Genomic Location:
Chromosome 15 (position 27858699)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGGTCAATAAAATGAAYCTCTCTCTGTCTTAAAGGTCGATTTGGAAGTGT[T/A]GGACCCACGGGGCCGGACTCCTTTRCACCTTGCAGTGACGCTGGGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22662
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015286 Nonsense 110 632 3 15
Genomic Location:
Chromosome 15 (position 27860974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGTACGGCTGGCGCTGCGTTACCGTGACTACCAGCGTACCACTAAA[C/T]GACTGGCAGGGATCCCGCGTCTGCTGGAGAGACTCCGACAGGTCAGCCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10858
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000015286 Essential Splice Site 138 632 4 15
Genomic Location:
Chromosome 15 (position 27861488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGGCACAGGATTTTTACGTGGAGATGAAATGGGAGTTTACCAGTTGGG[G/A]TAGGTCTTATCTCTAGTAATGTGGYGTAAATGGTATGCTTAAAAAGCRCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6hb80m3i