mbtps1

Ensembl ID:
ENSDARG00000014634
ZFIN ID:
ZDB-GENE-030131-4909
Description:
membrane-bound transcription factor site-1 protease [Source:RefSeq peptide;Acc:NP_954683]
Human Orthologue:
MBTPS1
Human Description:
membrane-bound transcription factor peptidase, site 1 [Source:HGNC Symbol;Acc:15456]
Mouse Orthologue:
Mbtps1
Mouse Description:
membrane-bound transcription factor peptidase, site 1 Gene [Source:MGI Symbol;Acc:MGI:1927235]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14973 Essential Splice Site Available for shipment Available now
sa2996 Nonsense Mutation detected in F1 DNA During 2014
sa9659 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14973
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019861 Essential Splice Site 151 1074 3 23
ENSDART00000114292 Essential Splice Site 151 1067 2 23
Genomic Location:
Chromosome 18 (position 21454866)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGTGTGACGCCACAGCGCATGGTCCTCCGCAGCCTTAAATTCACAGACTG[T/C]AAGTAGTCGTGTTGTCAAARTAATTCATACAYATGCAATATCASTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2996
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019861 Nonsense 172 1074 4 23
ENSDART00000114292 Nonsense 172 1067 3 23
Genomic Location:
Chromosome 18 (position 21448082)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCGTCCCCATGCAATGACACACGCTGGGTGCAGAAGTGGCAGTCGTGG[C/T]AGTCATCAAGGCCACTCAGGAGGACTAGTCTGTCTCTGAGCTCTGGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9659
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019861 Nonsense 522 1074 12 23
ENSDART00000114292 Nonsense 522 1067 11 23
Genomic Location:
Chromosome 18 (position 21437247)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGACCGAGTGCCCRTACATGTGGCCCTACTGCTCTCAGCCCATTWACTA[C/A]GGTGGCATGCCAACAATCGTCAACGTGACCATTCTTAATGGTATGGGCGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/vf0jnbrv