dlx3b

Ensembl ID:
ENSDARG00000014626
ZFIN ID:
ZDB-GENE-980526-280
Description:
Homeobox protein Dlx3b [Source:UniProtKB/Swiss-Prot;Acc:Q01702]
Human Orthologue:
DLX3
Human Description:
distal-less homeobox 3 [Source:HGNC Symbol;Acc:2916]
Mouse Orthologue:
Dlx3
Mouse Description:
distal-less homeobox 3 Gene [Source:MGI Symbol;Acc:MGI:94903]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa94 Missense Confirmed mutation in F2 line During 2017
sa22023 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa94
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017191 Missense 1 269 1 3
Genomic Location (Zv9):
Chromosome 12 (position 6077717)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5673608
KASP Assay ID:
554-0022.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTGGAAATAAAGTGGACGATCGTTGTTTTTTCCTTCCTTATTAAGGAT[G/T]AGTGGACCGACATATGACAGGAAGATACCCGGTATTTCGACCGATCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22023
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017191 Nonsense 237 269 3 3
Genomic Location (Zv9):
Chromosome 12 (position 6075079)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5676246
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAACCGGGGGCAGATCCCCCAGCCACCCCTCAGTTCCACACCCCCCTA[C/A]ATGGAAGATTACAGCAATCACTGGTACCAGCAGGGATCACATTTACAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link