adcy2b

Ensembl ID:
ENSDARG00000014588
ZFIN ID:
ZDB-GENE-060503-69
Description:
adenylate cyclase type 2 [Source:RefSeq peptide;Acc:NP_001093457]
Human Orthologue:
ADCY2
Human Description:
adenylate cyclase 2 (brain) [Source:HGNC Symbol;Acc:233]
Mouse Orthologue:
Adcy2
Mouse Description:
adenylate cyclase 2 Gene [Source:MGI Symbol;Acc:MGI:99676]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4080 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13913 Nonsense Available for shipment Available now
sa10292 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4080
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046166 Essential Splice Site 470 1142 8 25
ENSDART00000135348 Essential Splice Site 470 1139 8 25
Genomic Location:
Chromosome 19 (position 28161683)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCACATGATGTCACCCTGGCCAATCACATGGAGGCGGGCGGTGTTCCTGG[G/A]TAAAATCGTCARATGACTTTTGTTTTTCTCYCATTTCATGATTTTCATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046166 Nonsense 920 1142 20 25
ENSDART00000135348 Nonsense 917 1139 20 25
Genomic Location:
Chromosome 19 (position 28108912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGGTGCTTTTRGAGAACGTTCTACCTGCCCATGTGGCCGAACATTTCT[T/A]GGGCCGGAACTGGAWGAATGAGGTAAGTGGTGTCCAAATGTCTAAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046166 Nonsense 1137 1142 25 25
ENSDART00000135348 Nonsense 1134 1139 25 25
Genomic Location:
Chromosome 19 (position 28095611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATCTGCGAAYCTTCTTYGTCCACACCGAGATGACGCAGTCTTTATCA[C/T]AAGGGAWTGTAATGCCTTGAACCCAAGTCCCACACATCGTACACGATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kj5vtcz9