adcy2b

Ensembl ID:
ENSDARG00000014588
ZFIN ID:
ZDB-GENE-060503-69
Description:
adenylate cyclase type 2 [Source:RefSeq peptide;Acc:NP_001093457]
Human Orthologue:
ADCY2
Human Description:
adenylate cyclase 2 (brain) [Source:HGNC Symbol;Acc:233]
Mouse Orthologue:
Adcy2
Mouse Description:
adenylate cyclase 2 Gene [Source:MGI Symbol;Acc:MGI:99676]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13913 Nonsense Available for shipment Available now
sa10292 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13913
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046166 Nonsense 920 1142 20 25
ENSDART00000135348 Nonsense 917 1139 20 25
Genomic Location (Zv9):
Chromosome 19 (position 28108912)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28039024
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGGGTGCTTTTRGAGAACGTTCTACCTGCCCATGTGGCCGAACATTTCT[T/A]GGGCCGGAACTGGAWGAATGAGGTAAGTGGTGTCCAAATGTCTAAGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10292
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000046166 Nonsense 1137 1142 25 25
ENSDART00000135348 Nonsense 1134 1139 25 25
Genomic Location (Zv9):
Chromosome 19 (position 28095611)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 28025723
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGATCTGCGAAYCTTCTTYGTCCACACCGAGATGACGCAGTCTTTATCA[C/T]AAGGGAWTGTAATGCCTTGAACCCAAGTCCCACACATCGTACACGATATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link