exoc3

Ensembl ID:
ENSDARG00000014582
ZFIN ID:
ZDB-GENE-030131-5947
Description:
exocyst complex component 3 [Source:RefSeq peptide;Acc:NP_997880]
Human Orthologue:
EXOC3
Human Description:
exocyst complex component 3 [Source:HGNC Symbol;Acc:30378]
Mouse Orthologue:
Exoc3
Mouse Description:
exocyst complex component 3 Gene [Source:MGI Symbol;Acc:MGI:2443972]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19896 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19896
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009347 Essential Splice Site 431 748 7 13

The following transcripts of ENSDARG00000014582 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 50684107)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTTAATCCCCCTACTTATACGAGTTCAACATGAGATCCTCCTCTTCA[G/A]ATGTTCGAGCAGAATCTTCAGGTCGCCGCTCAGATTAATGAGATCTTCAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ulcerative colitis: Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/nyziazvq