rhpn2

Ensembl ID:
ENSDARG00000014577
ZFIN ID:
ZDB-GENE-030131-9927
Description:
Rhophilin-2 [Source:UniProtKB/Swiss-Prot;Acc:Q6TNR1]
Human Orthologues:
AC126603.1, RHPN2
Human Descriptions:
Putative rhophilin-2-like protein [Source:UniProtKB/Swiss-Prot;Acc:A8MT19]
rhophilin, Rho GTPase binding protein 2 [Source:HGNC Symbol;Acc:19974]
Mouse Orthologue:
Rhpn2
Mouse Description:
rhophilin, Rho GTPase binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:1289234]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21021 Nonsense Mutation detected in F1 DNA During 2014
sa1319 Essential Splice Site Available for shipment Available now
sa10688 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21021
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010046 Nonsense 137 683 5 15

The following transcripts of ENSDARG00000014577 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 39764926)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATGGGTACAAAAATGATTTATTTGAACAGGACTTCATCCTGGAACACTA[C/A]AGTGAAGATGGCTCAAACTTCCAGAATCAGATCGATGACCTCATGGACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1319
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010046 Essential Splice Site 473 683 11 15

The following transcripts of ENSDARG00000014577 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 39774234)
KASP Assay ID:
554-1233.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACAAGGAAGACGAGTTCACAGACTACATGCTTGCACCAGATATTATCT[G/A]TAAGTCAGAGATGGACACTATTGGAACCRCCRTTTTATTAGAACAGAATC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa10688
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010046 Nonsense 531 683 13 15

The following transcripts of ENSDARG00000014577 do not overlap with this mutation:

Genomic Location:
Chromosome 7 (position 39777607)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CRCGCACCATCAGGCTCATACTGCAGGACAGAGACCTCGGGTTTACRCTC[A/T]AGGGAGATGCACCCGTTCAGATACAGTCRCTCGACCCCCTTTGTCCCGCW
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ytd8yzqb