ghitm

Ensembl ID:
ENSDARG00000014573
ZFIN ID:
ZDB-GENE-040426-1537
Description:
growth hormone-inducible transmembrane protein [Source:RefSeq peptide;Acc:NP_956885]
Human Orthologue:
GHITM
Human Description:
growth hormone inducible transmembrane protein [Source:HGNC Symbol;Acc:17281]
Mouse Orthologue:
Ghitm
Mouse Description:
growth hormone inducible transmembrane protein Gene [Source:MGI Symbol;Acc:MGI:1913342]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa8494 Essential Splice Site Mutation detected in F1 DNA During 2017
sa42102 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa8494
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034768 Essential Splice Site 73 120 2 3
Genomic Location (Zv9):
Chromosome 12 (position 50615600)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48982444
KASP Assay ID:
2260-5830.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTACGGTCTCGGCATGTCCAGTGAGATYGGGGCCAWCGAGAAGGCAGCG[T/C]AAGAGTTTGAGCCTGACTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42102
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034768 Nonsense 119 120 3 3
Genomic Location (Zv9):
Chromosome 12 (position 50615119)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 48981963
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCATCAGCAGGACCCCGGTGCTCATGGGGATCATGATGAGCAACTCCTG[G/A]CTGGTACGCACACGCATACACACACACACACGCGGAGGTGATGCGCAGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link