eif4e1b

Ensembl ID:
ENSDARG00000014565
ZFIN ID:
ZDB-GENE-980526-127
Description:
Eukaryotic translation initiation factor 4E-1B [Source:UniProtKB/Swiss-Prot;Acc:Q9PW28]
Human Orthologue:
EIF4E1B
Human Description:
eukaryotic translation initiation factor 4E family member 1B [Source:HGNC Symbol;Acc:33179]
Mouse Orthologues:
AC138218.1, Eif4e1b
Mouse Description:
eukaryotic translation initiation factor 4E family member 1B Gene [Source:MGI Symbol;Acc:MGI:2685119

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20588 Essential Splice Site Available for shipment Available now
sa40603 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa20588
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017881 Essential Splice Site 71 214 3 7
Genomic Location (Zv9):
Chromosome 5 (position 71170881)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67121354
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAATCTAAGGCTCATCACCAAATTCGACACGGTCGAGGACTTCTGGGGG[T/A]AAGTTATGCTCAAGACCTCTTAAAGGTTGAATGCCTTTAAAATCCAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40603
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000017881 Essential Splice Site 177 214 6 7
Genomic Location (Zv9):
Chromosome 5 (position 71179846)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 67113684
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCTCTGGACATCCAATGCTGAGAACTGTGAGACGGTCACATATATAGG[G/A]TAAGCATGCTTTTAAATCCATGCTTTTTATGGCCAATATTTTAACTTTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link