ppp1r3cb

Ensembl ID:
ENSDARG00000014554
ZFIN ID:
ZDB-GENE-040426-1733
Description:
Protein phosphatase 1 regulatory subunit 3C-B [Source:UniProtKB/Swiss-Prot;Acc:Q6P950]
Human Orthologue:
PPP1R3C
Human Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3C [Source:HGNC Symbol;Acc:9293]
Mouse Orthologue:
Ppp1r3c
Mouse Description:
protein phosphatase 1, regulatory (inhibitor) subunit 3C Gene [Source:MGI Symbol;Acc:MGI:1858229]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22066 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22066
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013360 Nonsense 141 317 2 2
ENSDART00000141169   None 52 2 2
Genomic Location (Zv9):
Chromosome 12 (position 17357758)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 16237468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTGGCCTGAAAGCAGAGAAGGAGAAGAATTTCAGTTTAGGCTTCCCT[C/T]AACCTGCCGCCGACTATTTGGACTTCCGGAACCGTCTAAAGAAGAACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link