rfx3

Ensembl ID:
ENSDARG00000014550
ZFIN ID:
ZDB-GENE-061103-253
Description:
Transcription factor RFX3 [Source:UniProtKB/Swiss-Prot;Acc:A0JMF8]
Human Orthologue:
RFX3
Human Description:
regulatory factor X, 3 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9984]
Mouse Orthologue:
Rfx3
Mouse Description:
regulatory factor X, 3 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:106582]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16866 Nonsense Available for shipment Available now
sa17373 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041236 Nonsense 139 765 4 17
ENSDART00000144234 Nonsense 139 382 3 8
ENSDART00000144882 Nonsense 139 542 4 13
ENSDART00000041236 Nonsense 139 765 4 17
ENSDART00000144234 Nonsense 139 382 3 8
ENSDART00000144882 Nonsense 139 542 4 13
Genomic Location:
Chromosome 10 (position 605029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTATGGGGCTCACCGGAGGYCAGAKCATCAGCAGCTCAGGAGCTTA[T/A]CTGATTRGAGGAAACTCCATGGATGGCTCCGCCCCTCACGGCGCCGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041236 Nonsense 139 765 4 17
ENSDART00000144234 Nonsense 139 382 3 8
ENSDART00000144882 Nonsense 139 542 4 13
ENSDART00000041236 Nonsense 139 765 4 17
ENSDART00000144234 Nonsense 139 382 3 8
ENSDART00000144882 Nonsense 139 542 4 13
Genomic Location:
Chromosome 10 (position 605029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTATGGGGCTCACCGGAGGYCAGAKCATCAGCAGCTCAGGAGCTTA[T/A]CTGATTRGAGGAAACTCCATGGATGGCTCCGCCCCTCACGGCGCCGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/ucxz2apq