rfx3

Ensembl ID:
ENSDARG00000014550
ZFIN ID:
ZDB-GENE-061103-253
Description:
Transcription factor RFX3 [Source:UniProtKB/Swiss-Prot;Acc:A0JMF8]
Human Orthologue:
RFX3
Human Description:
regulatory factor X, 3 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9984]
Mouse Orthologue:
Rfx3
Mouse Description:
regulatory factor X, 3 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:106582]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31758 Nonsense Mutation detected in F1 DNA During 2016
sa16866 Nonsense Available for shipment Available now
sa17373 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31758
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041236 Nonsense 40 765 2 17
ENSDART00000144234 Nonsense 40 382 1 8
ENSDART00000144882 Nonsense 40 542 2 13
Genomic Location:
Chromosome 10 (position 612590)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGCCTGCGGTCAGTGGCCAGCAGGTGGCGTCTCAGGTGCCCGTCCAG[C/T]AGCAGGTGAGCCTCTGCACACATCTCTCTCTCTCTCTCTGTGTGCTGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041236 Nonsense 139 765 4 17
ENSDART00000144234 Nonsense 139 382 3 8
ENSDART00000144882 Nonsense 139 542 4 13
ENSDART00000041236 Nonsense 139 765 4 17
ENSDART00000144234 Nonsense 139 382 3 8
ENSDART00000144882 Nonsense 139 542 4 13
Genomic Location:
Chromosome 10 (position 605029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTATGGGGCTCACCGGAGGYCAGAKCATCAGCAGCTCAGGAGCTTA[T/A]CTGATTRGAGGAAACTCCATGGATGGCTCCGCCCCTCACGGCGCCGCACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17373
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041236 Nonsense 139 765 4 17
ENSDART00000144234 Nonsense 139 382 3 8
ENSDART00000144882 Nonsense 139 542 4 13
ENSDART00000041236 Nonsense 139 765 4 17
ENSDART00000144234 Nonsense 139 382 3 8
ENSDART00000144882 Nonsense 139 542 4 13
Genomic Location:
Chromosome 10 (position 605029)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGCTATGGGGCTCACCGGAGGYCAGAKCATCAGCAGCTCAGGAGCTTA[T/A]CTGATTRGAGGAAACTCCATGGATGGCTCCGCCCCTCACGGCGCCGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link