golim4b

Ensembl ID:
ENSDARG00000014545
ZFIN ID:
ZDB-GENE-050327-74
Description:
golgi integral membrane protein 4b [Source:RefSeq peptide;Acc:NP_001014371]
Human Orthologue:
GOLIM4
Human Description:
golgi integral membrane protein 4 [Source:HGNC Symbol;Acc:15448]
Mouse Orthologue:
Golim4
Mouse Description:
golgi integral membrane protein 4 Gene [Source:MGI Symbol;Acc:MGI:1920374]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14496 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14496
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000002510 Nonsense 10 478 1 13
Genomic Location:
Chromosome 2 (position 36422428)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTCAAGAAGAGRAGGAAAAAAGATGGGGAAAGGGATTTGTTCGAGACGA[C/T]AGAGAAGAATATTTCAGTCTTTCCTCCTTGTCATCTTCGTCTGCGGGACR
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/z505pkoj