atg4a

Ensembl ID:
ENSDARG00000014531
ZFIN ID:
ZDB-GENE-050522-430
Description:
cysteine protease ATG4A [Source:RefSeq peptide;Acc:NP_001019605]
Human Orthologue:
ATG4A
Human Description:
ATG4 autophagy related 4 homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:16489]
Mouse Orthologue:
Atg4a
Mouse Description:
autophagy-related 4A (yeast) Gene [Source:MGI Symbol;Acc:MGI:2147903]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24031 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa24031
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026666 Essential Splice Site 250 375 10 13
Genomic Location (Zv9):
Chromosome 21 (position 41905210)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43504256
KASP Assay ID:
2261-6082.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGCAGTGTATGAATGTGTTATTGAAGCATTATGACTGTTTGCTTCTTC[A/C]GATGACGAGTTGATTTATCTGGATCCTCACACGACGCAGCAGGCCGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link