cdh6

Ensembl ID:
ENSDARG00000014522
ZFIN ID:
ZDB-GENE-050320-92
Description:
cadherin-6 [Source:RefSeq peptide;Acc:NP_001013538]
Human Orthologues:
CDH10, CDH6, CDH9
Human Descriptions:
cadherin 10, type 2 (T2-cadherin) [Source:HGNC Symbol;Acc:1749]
cadherin 6, type 2, K-cadherin (fetal kidney) [Source:HGNC Symbol;Acc:1765]
cadherin 9, type 2 (T1-cadherin) [Source:HGNC Symbol;Acc:1768]
Mouse Orthologues:
Cdh10, Cdh6, Cdh9
Mouse Descriptions:
cadherin 10 Gene [Source:MGI Symbol;Acc:MGI:107436]
cadherin 6 Gene [Source:MGI Symbol;Acc:MGI:107435]
cadherin 9 Gene [Source:MGI Symbol;Acc:MGI:107433]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19781 Nonsense Available for shipment Available now
sa5143 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa19781
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013638 Nonsense 241 794 5 12
ENSDART00000131506 Nonsense 241 794 4 11
Genomic Location:
Chromosome 2 (position 28245094)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAAAGGGAGCACTACCAAGTGGTGATCGAAGCCAAGGACATGGCCGGC[C/T]AGAAGGGAGGCTTAATAGGCTCCACCACAGTCAACATTAGCCTTACCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5143
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013638 Nonsense 736 794 12 12
ENSDART00000131506 Nonsense 736 794 11 11
Genomic Location:
Chromosome 2 (position 28218788)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCAACCAGCGTGTGGAGGAAAATGAYGGCAACCCTACMGCTCCTCCTTA[T/A]GACTCTCTGGCCACCTACGCCTACGAAGGTAATGGATCGGTGGCMGAGTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dfql5qx9