usp5

Ensembl ID:
ENSDARG00000014517
ZFIN ID:
ZDB-GENE-040426-2584
Description:
ubiquitin carboxyl-terminal hydrolase 5 [Source:RefSeq peptide;Acc:NP_999920]
Human Orthologue:
USP5
Human Description:
ubiquitin specific peptidase 5 (isopeptidase T) [Source:HGNC Symbol;Acc:12628]
Mouse Orthologue:
Usp5
Mouse Description:
ubiquitin specific peptidase 5 (isopeptidase T) Gene [Source:MGI Symbol;Acc:MGI:1347343]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9178 Nonsense Mutation detected in F1 DNA During 2016
sa14716 Nonsense Available for shipment Available now
sa17405 Nonsense Available for shipment Available now
sa22772 Essential Splice Site Available for shipment Available now
sa36058 Nonsense Mutation detected in F1 DNA During 2016
sa36057 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa9178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Nonsense 117 853 4 20
Genomic Location (Zv9):
Chromosome 16 (position 13732302)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12091393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTNGCAGGTATTGAGGGAGGGTTYGATGTTGAGCAGGAGCAGTATGAAGAA[G/T]AGGTCAAGGTGGTTCTTTTCCCAGAYCGACAGGAAGTGACACTGGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Nonsense 197 853 6 20
Genomic Location (Zv9):
Chromosome 16 (position 13729666)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12088757
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGTAAGTAAYAGRAGGTGACTGTTYGCKCTTTCAGTGGCKGGAAGTG[T/A]GAGGTCTGTGAGCTGCAGGAGAACCTGTGGATGAATCTGAYGGACGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Nonsense 237 853 6 20
Genomic Location (Zv9):
Chromosome 16 (position 13729548)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12088639
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRTATTTTGATGGCTCTGGGGGGAATAACCATGCCCTCCTGTACTACCAG[C/T]AGACYGGATACCCAYTAGCTGTYAAACTCGGCACAATAACACCTGAYGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22772
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Essential Splice Site 405 853 10 20
Genomic Location (Zv9):
Chromosome 16 (position 13724971)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12084062
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCCCCAGACCCCGCAGATGAACCTAACACCTCTGCTGAACCCAGGG[T/C]ACACACACTTACAGTTCTCATGTATTGGGTTGTATTAAAAACAAATAGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36058
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Nonsense 432 853 11 20
Genomic Location (Zv9):
Chromosome 16 (position 13724697)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12083788
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCAAAGCTCTGGTTGGACGAGGCCACCCTGAGTTCTCCACCAATCGG[C/T]AACAGGATGCACAAGAGTTTCTTCTTCACTTCATAAATATGGTGGAGGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36057
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Nonsense 472 853 12 20
Genomic Location (Zv9):
Chromosome 16 (position 13724497)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12083588
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCCTTCAGAAGCTTTCAGATTCTTGGTAGAGGAGAAGATTGTATGCCAA[C/T]AATCACAAAAAGCCAAGTATACCCAGCGAGTTGACTATATCGTCCAGCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link