usp5

Ensembl ID:
ENSDARG00000014517
ZFIN ID:
ZDB-GENE-040426-2584
Description:
ubiquitin carboxyl-terminal hydrolase 5 [Source:RefSeq peptide;Acc:NP_999920]
Human Orthologue:
USP5
Human Description:
ubiquitin specific peptidase 5 (isopeptidase T) [Source:HGNC Symbol;Acc:12628]
Mouse Orthologue:
Usp5
Mouse Description:
ubiquitin specific peptidase 5 (isopeptidase T) Gene [Source:MGI Symbol;Acc:MGI:1347343]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9178 Nonsense Mutation detected in F1 DNA During 2014
sa14716 Nonsense Available for shipment Available now
sa17405 Nonsense Available for shipment Available now
sa22772 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa9178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Nonsense 117 853 4 20
Genomic Location:
Chromosome 16 (position 13732302)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YTNGCAGGTATTGAGGGAGGGTTYGATGTTGAGCAGGAGCAGTATGAAGAA[G/T]AGGTCAAGGTGGTTCTTTTCCCAGAYCGACAGGAAGTGACACTGGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14716
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Nonsense 197 853 6 20
Genomic Location:
Chromosome 16 (position 13729666)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGAGTAAGTAAYAGRAGGTGACTGTTYGCKCTTTCAGTGGCKGGAAGTG[T/A]GAGGTCTGTGAGCTGCAGGAGAACCTGTGGATGAATCTGAYGGACGGGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17405
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Nonsense 237 853 6 20
Genomic Location:
Chromosome 16 (position 13729548)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GRTATTTTGATGGCTCTGGGGGGAATAACCATGCCCTCCTGTACTACCAG[C/T]AGACYGGATACCCAYTAGCTGTYAAACTCGGCACAATAACACCTGAYGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22772
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029121 Essential Splice Site 405 853 10 20
Genomic Location:
Chromosome 16 (position 13724971)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAGCCCCAGACCCCGCAGATGAACCTAACACCTCTGCTGAACCCAGGG[T/C]ACACACACTTACAGTTCTCATGTATTGGGTTGTATTAAAAACAAATAGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zeoban5b