PRPF6 (1 of 2)

Ensembl ID:
ENSDARG00000014500
Description:
PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:15860]
Human Orthologue:
PRPF6
Human Description:
PRP6 pre-mRNA processing factor 6 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:15860]
Mouse Orthologue:
Prpf6
Mouse Description:
PRP6 pre-mRNA splicing factor 6 homolog (yeast) Gene [Source:MGI Symbol;Acc:MGI:1922946]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44995 Nonsense Mutation detected in F1 DNA During 2017
sa1110 Essential Splice Site F2 line generated During 2017

Mutation Details

Allele Name:
sa44995
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026812 Nonsense 116 252 2 5
Genomic Location (Zv9):
Chromosome 23 (position 7300444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGAAAAGCCAGGATGATGATGACGAGGATCTCAACGACACCAATTA[T/A]GATGAGGTACATTTCGCAGGCGTCATATTGAGTTGATGTGCCAAAATGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1110
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000026812 Essential Splice Site 158 252 3 5
Genomic Location (Zv9):
Chromosome 23 (position 7300659)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 7112786
KASP Assay ID:
554-1012.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTATGCTGCACTGGATAAAAGAATGGATGAGAGACGGAAAGAAAGAAGG[T/C]GAGCTTGACCTTTCTTCWGTCGTCTACWCTTGCTGTTTATGTAGAGCGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link