yth2

Ensembl ID:
ENSDARG00000014498
ZFIN ID:
ZDB-GENE-040426-948
Description:
YTH domain family protein 2 [Source:RefSeq peptide;Acc:NP_956544]
Human Orthologue:
YTHDF2
Human Description:
YTH domain family, member 2 [Source:HGNC Symbol;Acc:31675]
Mouse Orthologue:
Ythdf2
Mouse Description:
YTH domain family 2 Gene [Source:MGI Symbol;Acc:MGI:2444233]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36430 Nonsense Mutation detected in F1 DNA During 2016
sa1176 Nonsense Confirmed mutation in F2 line During 2016

Mutation Details

Allele Name:
sa36430
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127043 Nonsense 25 613 3 6
Genomic Location (Zv9):
Chromosome 17 (position 27275965)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 27400081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTACCTTAACTTTCTCTGTTTTCTTTTCAGTACAAAACGGAGCTGTTACC[C/T]AAAAGGATACTTTGAACGATGATGAGTTCGAGCCTTACCTGAATGCTCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1176
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127043 Nonsense 149 613 4 6
Genomic Location (Zv9):
Chromosome 17 (position 27273787)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 27397903
KASP Assay ID:
554-1086.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTGGGGCAACAGCAGCTCTCAGGGACAGTCCACACAGAGTTCAGGTTA[C/A]AGCAGCAGTTACGCCTATGCCCCTAGCACGCTAGGAGGTGCAATGATTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link