trpv6

Ensembl ID:
ENSDARG00000014496
ZFIN ID:
ZDB-GENE-040624-12
Description:
transient receptor potential cation channel subfamily V member 6 [Source:RefSeq peptide;Acc:NP_0010
Human Orthologues:
TRPV5, TRPV6
Human Descriptions:
transient receptor potential cation channel, subfamily V, member 5 [Source:HGNC Symbol;Acc:3145]
transient receptor potential cation channel, subfamily V, member 6 [Source:HGNC Symbol;Acc:14006]
Mouse Orthologues:
Trpv5, Trpv6
Mouse Descriptions:
transient receptor potential cation channel, subfamily V, member 5 Gene [Source:MGI Symbol;Acc:MGI:2
transient receptor potential cation channel, subfamily V, member 6 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17082 Essential Splice Site Available for shipment Available now
sa1510 Essential Splice Site Available for shipment Available now
sa16780 Nonsense Available for shipment Available now
sa25007 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17082
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123927 Essential Splice Site 485 711 13 17
ENSDART00000127453 Essential Splice Site 483 709 13 17
Genomic Location:
Chromosome 16 (position 14052417)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGCCCGGGGTTTYGAGATGCTGGGACCCTACGTCATTGTGATACAGAAG[G/T]TGGGGTGATTCYCTGGTTTGAAGATCARCCATAAATATAATATGCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1510
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123927 Essential Splice Site 508 711 15 17
ENSDART00000127453 Essential Splice Site 506 709 15 17
Genomic Location:
Chromosome 16 (position 14048093)
KASP Assay ID:
554-1434.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTAAGCCTTTGAATCTGTAACCTTAATAACTTACTTGTTTTCCTGTGC[A/C]GCCTTGTGGATTTTCTACATGACTCAGGAACCCTTAGCACTTCCGCAGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16780
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123927 Nonsense 584 711 15 17
ENSDART00000127453 Nonsense 582 709 15 17
Genomic Location:
Chromosome 16 (position 14047862)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAYGTCCTCCTGTTTAATCTCCTGGTCGCCATGATGAGTGACACTCAGTG[G/A]AGAGTAACTCAAGAACGTGRYGAGCTCTGGAGGACGCAGGTYAGTACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123927 Nonsense 607 711 16 17
ENSDART00000127453 Nonsense 605 709 16 17
Genomic Location:
Chromosome 16 (position 14047715)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAGTTGGTTTCTCTTTTCATAGGTGGTGGCCACTACTCTGATGCTTGAA[C/T]GAAAGTTGCCACAGTGCCTGTGGCCAAGATTGGGTGTCTGTGGTCTGATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/koz3y0ec