trpv6
- Ensembl ID:
- ENSDARG00000014496
- ZFIN ID:
- ZDB-GENE-040624-12
- Description:
- transient receptor potential cation channel subfamily V member 6 [Source:RefSeq peptide;Acc:NP_0010
- Human Orthologues:
- TRPV5, TRPV6
- Human Descriptions:
- transient receptor potential cation channel, subfamily V, member 5 [Source:HGNC Symbol;Acc:3145]
- transient receptor potential cation channel, subfamily V, member 6 [Source:HGNC Symbol;Acc:14006]
- Mouse Orthologues:
- Trpv5, Trpv6
- Mouse Descriptions:
- transient receptor potential cation channel, subfamily V, member 5 Gene [Source:MGI Symbol;Acc:MGI:2
- transient receptor potential cation channel, subfamily V, member 6 Gene [Source:MGI Symbol;Acc:MGI:1
Alleles
There are 6 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa17082 |
Essential Splice Site |
Available for shipment |
Available now |
sa42674 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa1510 |
Essential Splice Site |
Available for shipment |
Available now |
sa16780 |
Nonsense |
Available for shipment |
Available now |
sa25007 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa42673 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa17082
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123927 |
Essential Splice Site |
485 |
711 |
13 |
17 |
ENSDART00000127453 |
Essential Splice Site |
483 |
709 |
13 |
17 |
- Genomic Location (Zv9):
- Chromosome 16 (position 14052417)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
12411508 |
GRCz11 |
16 |
12302410 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTGCCCGGGGTTTYGAGATGCTGGGACCCTACGTCATTGTGATACAGAAG[G/T]TGGGGTGATTCYCTGGTTTGAAGATCARCCATAAATATAATATGCATTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42674
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14052287)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
12411378 |
GRCz11 |
16 |
12302280 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TATTTGGAGATATAACAAAGTTCATGTGGTTGTCCATCATCTTCCTCATT[G/T]GATCTTCTGCTGGTTAGTTCAAATACATTTACACTGTATTCATGTGAAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1510
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- A > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123927 |
Essential Splice Site |
508 |
711 |
15 |
17 |
ENSDART00000127453 |
Essential Splice Site |
506 |
709 |
15 |
17 |
- Genomic Location (Zv9):
- Chromosome 16 (position 14048093)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
12407184 |
GRCz11 |
16 |
12298086 |
- KASP Assay ID:
- 554-1434.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTGTAAGCCTTTGAATCTGTAACCTTAATAACTTACTTGTTTTCCTGTGC[A/C]GCCTTGTGGATTTTCTACATGACTCAGGAACCCTTAGCACTTCCGCAGTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16780
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14047862)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
12406953 |
GRCz11 |
16 |
12297855 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAYGTCCTCCTGTTTAATCTCCTGGTCGCCATGATGAGTGACACTCAGTG[G/A]AGAGTAACTCAAGAACGTGRYGAGCTCTGGAGGACGCAGGTYAGTACTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25007
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 16 (position 14047715)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
12406806 |
GRCz11 |
16 |
12297708 |
- KASP Assay ID:
- 554-7498.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAGTTGGTTTCTCTTTTCATAGGTGGTGGCCACTACTCTGATGCTTGAA[C/T]GAAAGTTGCCACAGTGCCTGTGGCCAAGATTGGGTGTCTGTGGTCTGATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42673
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123927 |
Essential Splice Site |
633 |
711 |
16 |
17 |
ENSDART00000127453 |
Essential Splice Site |
631 |
709 |
16 |
17 |
- Genomic Location (Zv9):
- Chromosome 16 (position 14047634)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
16 |
12406725 |
GRCz11 |
16 |
12297627 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGGTGTCTGTGGTCTGATGTTTGGGCTTGGAGAGCGCTGGTATCTTCGG[T/C]AAGATCACAATCACAATTATAAAAAGTACATTTCAAATTAATTTTACATT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: