trpv6

Ensembl ID:: ENSDARG00000014496
ZFIN ID:: ZDB-GENE-040624-12
Description:: transient receptor potential cation channel subfamily V member 6 [Source:RefSeq peptide;Acc:NP_0010
Human Orthologues:: TRPV5, TRPV6
Human Descriptions:: transient receptor potential cation channel, subfamily V, member 5 [Source:HGNC Symbol;Acc:3145]; transient receptor potential cation channel, subfamily V, member 6 [Source:HGNC Symbol;Acc:14006]
Mouse Orthologues:: Trpv5, Trpv6
Mouse Descriptions:: transient receptor potential cation channel, subfamily V, member 5 Gene [Source:MGI Symbol;Acc:MGI:2; transient receptor potential cation channel, subfamily V, member 6 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 4 alleles of this gene:

Allele name	Consequence	Status	Availability Estimate
sa17082	Essential Splice Site	Available for shipment	Available now
sa1510	Essential Splice Site	Available for shipment	Available now
sa16780	Nonsense	Available for shipment	Available now
sa25007	Nonsense	Mutation detected in F1 DNA	During 2015

Mutation Details

Allele Name:: sa17082
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > T
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000123927	Essential Splice Site	485	711	13	17
ENSDART00000127453	Essential Splice Site	483	709	13	17

Genomic Location:: Chromosome 16 (position 14052417)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: TTGCCCGGGGTTTYGAGATGCTGGGACCCTACGTCATTGTGATACAGAAG[G/T]TGGGGTGATTCYCTGGTTTGAAGATCARCCATAAATATAATATGCATTTT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa1510
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: A > C
Consequence:: Essential Splice Site

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000123927	Essential Splice Site	508	711	15	17
ENSDART00000127453	Essential Splice Site	506	709	15	17

Genomic Location:: Chromosome 16 (position 14048093)
KASP Assay ID:: 554-1434.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: CTGTAAGCCTTTGAATCTGTAACCTTAATAACTTACTTGTTTTCCTGTGC[A/C]GCCTTGTGGATTTTCTACATGACTCAGGAACCCTTAGCACTTCCGCAGTA
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa16780
Current Status:: Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:: G > A
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000123927	Nonsense	584	711	15	17
ENSDART00000127453	Nonsense	582	709	15	17

Genomic Location:: Chromosome 16 (position 14047862)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: AAYGTCCTCCTGTTTAATCTCCTGGTCGCCATGATGAGTGACACTCAGTG[G/A]AGAGTAACTCAAGAACGTGRYGAGCTCTGGAGGACGCAGGTYAGTACTTT
Associated Phenotype:: Not determined

Mutation Details

Allele Name:: sa25007
Current Status:: Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:: We currently estimate that this allele will be available during 2015.
Mutation:: C > T
Consequence:: Nonsense

Transcript ID	Consequence	Amino Acid Affected	Amino Acid Total	Exon Affected	Exon Total
ENSDART00000123927	Nonsense	607	711	16	17
ENSDART00000127453	Nonsense	605	709	16	17

Genomic Location:: Chromosome 16 (position 14047715)
KASP Assay ID:: None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:: None
Flanking Sequence:: ACAGTTGGTTTCTCTTTTCATAGGTGGTGGCCACTACTCTGATGCTTGAA[C/T]GAAAGTTGCCACAGTGCCTGTGGCCAAGATTGGGTGTCTGTGGTCTGATG
Associated Phenotype:: Not determined

OMIM

OMIM information for TRPV5

OMIM information for TRPV6

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: