tac1

Ensembl ID:
ENSDARG00000014490
ZFIN ID:
ZDB-GENE-060503-904
Description:
Novel protein similar to human tachykinin, 1 (Substance K, substance P, neurokinin 1, neurokinin 2,
Human Orthologue:
TAC1
Human Description:
tachykinin, precursor 1 [Source:HGNC Symbol;Acc:11517]
Mouse Orthologue:
Tac1
Mouse Description:
tachykinin 1 Gene [Source:MGI Symbol;Acc:MGI:98474]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa14316 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa14316
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014674 Essential Splice Site 72 116 2 6
ENSDART00000146947 Essential Splice Site 72 114 2 5
Genomic Location:
Chromosome 19 (position 26136578)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAACCCCGACCTCATCAGTTYATCGGTCTGATGGGGAAACGGTCCTCTG[G/A]TAAGACCACACATGCAAACTRTAAAATATTCAGATATTAAATAAAATGCG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/231m8pz0