ca2

Ensembl ID:
ENSDARG00000014488
ZFIN ID:
ZDB-GENE-031219-5
Description:
carbonic anhydrase II [Source:RefSeq peptide;Acc:NP_954685]
Human Orthologues:
CA1, CA13, CA2, CA3
Human Descriptions:
carbonic anhydrase I [Source:HGNC Symbol;Acc:1368]
carbonic anhydrase II [Source:HGNC Symbol;Acc:1373]
carbonic anhydrase III, muscle specific [Source:HGNC Symbol;Acc:1374]
carbonic anhydrase XIII [Source:HGNC Symbol;Acc:14914]
Mouse Orthologues:
Car1, Car13, Car2, Car3
Mouse Descriptions:
carbonic anhydrase 1 Gene [Source:MGI Symbol;Acc:MGI:88268]
carbonic anhydrase 13 Gene [Source:MGI Symbol;Acc:MGI:1931322]
carbonic anhydrase 2 Gene [Source:MGI Symbol;Acc:MGI:88269]
carbonic anhydrase 3 Gene [Source:MGI Symbol;Acc:MGI:88270]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24528 Nonsense Mutation detected in F1 DNA During 2014
sa24527 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Nonsense 74 260 2 8
Genomic Location:
Chromosome 24 (position 33867488)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACATCCAGAACAATGGACACTCTTTCCAAGTGTCCTTCGTTGATGAT[C/T]AAAACAGCTCAAGTGTGTGACGCTTCTTCATTTTTTATACAAAACACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Nonsense 89 260 3 8
Genomic Location:
Chromosome 24 (position 33864267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTATTGTGTGTTTCAGCTCTGACTGGAGGCCCGGTCACAGGCACATTC[A/T]GACTCAAACAGTTTCACTTCCACTGGGGATCTGCAGACGACAAGGGCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/q11mauxu