ca2

Ensembl ID:
ENSDARG00000014488
ZFIN ID:
ZDB-GENE-031219-5
Description:
carbonic anhydrase II [Source:RefSeq peptide;Acc:NP_954685]
Human Orthologues:
CA1, CA13, CA2, CA3
Human Descriptions:
carbonic anhydrase I [Source:HGNC Symbol;Acc:1368]
carbonic anhydrase II [Source:HGNC Symbol;Acc:1373]
carbonic anhydrase III, muscle specific [Source:HGNC Symbol;Acc:1374]
carbonic anhydrase XIII [Source:HGNC Symbol;Acc:14914]
Mouse Orthologues:
Car1, Car13, Car2, Car3
Mouse Descriptions:
carbonic anhydrase 1 Gene [Source:MGI Symbol;Acc:MGI:88268]
carbonic anhydrase 13 Gene [Source:MGI Symbol;Acc:MGI:1931322]
carbonic anhydrase 2 Gene [Source:MGI Symbol;Acc:MGI:88269]
carbonic anhydrase 3 Gene [Source:MGI Symbol;Acc:MGI:88270]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24528 Nonsense Mutation detected in F1 DNA During 2016
sa37925 Essential Splice Site Mutation detected in F1 DNA During 2016
sa24527 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24528
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Nonsense 74 260 2 8
Genomic Location (Zv9):
Chromosome 24 (position 33867488)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32747415
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGACATCCAGAACAATGGACACTCTTTCCAAGTGTCCTTCGTTGATGAT[C/T]AAAACAGCTCAAGTGTGTGACGCTTCTTCATTTTTTATACAAAACACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37925
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Essential Splice Site 78 260 3 8
Genomic Location (Zv9):
Chromosome 24 (position 33864301)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32744228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCAAGTGTATGAAGCGGAGCATGACGGTTCTGATTTATTGTGTGTTTC[A/G]GCTCTGACTGGAGGCCCGGTCACAGGCACATTCAGACTCAAACAGTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24527
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000038364 Nonsense 89 260 3 8
Genomic Location (Zv9):
Chromosome 24 (position 33864267)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 32744194
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTATTGTGTGTTTCAGCTCTGACTGGAGGCCCGGTCACAGGCACATTC[A/T]GACTCAAACAGTTTCACTTCCACTGGGGATCTGCAGACGACAAGGGCTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link