nr6a1b

Ensembl ID:
ENSDARG00000014480
ZFIN ID:
ZDB-GENE-040724-202
Description:
Nuclear receptor subfamily 6 group A member 1-B [Source:UniProtKB/Swiss-Prot;Acc:Q4V8R7]
Human Orthologue:
NR6A1
Human Description:
nuclear receptor subfamily 6, group A, member 1 [Source:HGNC Symbol;Acc:7985]
Mouse Orthologue:
Nr6a1
Mouse Description:
nuclear receptor subfamily 6, group A, member 1 Gene [Source:MGI Symbol;Acc:MGI:1352459]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa29520 Essential Splice Site Mutation detected in F1 DNA During 2017
sa1764 Nonsense Available for shipment Available now
sa13776 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa29520
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011096 Essential Splice Site 75 421 2 9
ENSDART00000122773 Essential Splice Site 76 422 1 8
Genomic Location (Zv9):
Chromosome 21 (position 7739682)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8147233
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGTACTGTCGGCTGCAGAAGTGCCTACAGATGGGCATGAACCGCAAGG[G/A]TGAGACACACACACTTTGTATAGCTGTCTTTATGGGGACTTCCTATAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1764
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011096 Nonsense 365 421 8 9
ENSDART00000122773 Nonsense 366 422 7 8
Genomic Location (Zv9):
Chromosome 21 (position 7755404)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8162955
KASP Assay ID:
554-1757.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACGTTACTGGACGCTGTGTCGTGAGCTGACAGAACGACTTCATCCACAG[C/T]GACCCAAACGCTTYTCTGACATCATCACCTGCCTTACTGAGATACGCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13776
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000011096 Nonsense 412 421 9 9
ENSDART00000122773 Nonsense 413 422 8 8
Genomic Location (Zv9):
Chromosome 21 (position 7759475)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 8167026
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGCWGTTTAAGGCAGTACTGTATTCCTGCACAACCAATCAAAACCCAT[G/A]GCTACCCAAAAGCTCCACCTCCAGGACATAAACCACACCTTTAAATCCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link